| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCCACUCACCUCCUGAGGUGCUAAAGAACCCUGUGCUGCCUGUGACUC… | 460 nt | 0.6435 |
Enables identical protein binding activity. Involved in cognition. Acts upstream of or within cellular response to calcium ion. Located in cornified envelope and perinuclear region of cytoplasm. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the LCE1D as a skin-specific mRNA marker, demonstrating high specificity for skin with no cross-reactivity to other body fluids at an optimal input of 5 ng [Hanson et al. DOI:10.1016/j.fsigen.2012.01.004]. A subsequent collaborative exercise confirmed its detection in high-input skin samples but noted inconsistent detection in low-template contact traces, supporting its use in RNA/DNA co-extraction strategies for forensic tissue identification [Haas et al. DOI:10.1016/j.fsigen.2015.01.002].