| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCUGCUCUGACUCCCCAGGGACGUGUCUGUGCUUUUGCAUGUGACCAG… | 625 nt | 0.5664 |
Predicted to be involved in keratinization. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans demonstrated that the LCE2D is a skin-specific mRNA marker, part of the skin1 pentaplex, which was successfully detected in high-input skin samples but showed inconsistent detection in low-template contact traces like fingerprints and touched objects [Hanson et al. DOI:10.1016/j.fsigen.2012.01.004]. In a collaborative exercise, the LCE2D was detected in a skin RNA dilution series down to 0.8 ng input, though its expression in actual contact traces was sporadic, reflecting sensitivity limits in trace evidence [Haas et al. DOI:10.1016/j.fsigen.2015.01.002].