Basic Information

Symbol
LCN2
RNA class
mRNA
Alias
Lipocalin 2 NGAL Neutrophil Gelatinase-Associated Lipocalin Oncogene 24p3 24p3 25 KDa Alpha-2-Microglobulin-Related Subunit Of MMP-9 Siderocalin P25 Migration-Stimulating Factor Inhibitor Lipocalin 2 (Oncogene 24p3) Siderocalin LCN2 Lipocalin-2 MSFI HNL
Location (GRCh38)
9:128149071-128153453
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Cause of death analysis Mechanical injury analysis Other applications
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_005564.5
Sequence length
820.0 nt
GC content
0.5598

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-270.80 kcal/mol
Thermodynamic ensemble
Free energy: -284.96 kcal/mol
Frequency: 0.0000
Diversity: 172.66
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((.((.........((((((((((((........((((((..(((.(((((((((((..((....)).)))....((..(((((.(((((((((.((((((....))))))..)...))))).))))))))..))..((((((..((..........))..))))))...((....((((...))))....)).(((........))).))))))))))).)))))).))))))))))))..(((...(((..(......)..)))...)))..(((((........))))).((((((.............)))).))..((((((((..((((....))))....).)).)))))....((((.((((((((((.((((((......((((((((......))))))))(((.......)))..)))))).))).))))..))).))))))))))))))......................(((((((((....((((...))))....((((((((.((....(((......)))..(((((..(((.(((.(((....))).......(((((((.......).))))))...))).)))..))))).............)).)))))))).....((((........)))).(((((.((((.(((.((....)).)))..))))))))).)))))))))((((((....(((((...)))))((((((.........((((..(((((...(((......)))...)))))..........)))).......)).))))))))))..
Thermodynamic Ensemble Prediction
.((((((((,{(,{..{,,,.((((((((((((........((((((..(((.(((((((((((..((....}}.)))....((..(((((.((((((((,.((((((....))))))..,...)))))}})))))))..))..{{{{((,{({....|||...,,..})))}}..,||,,..((((...))))....,,.(((........))).))))))))))).)))))).))))))))))))..{((...(((..{......}..}}}...))}..(((((........))))).{{((((.............)))).},..((((((((..((((....))))....),}).)))))...||||{.||||{,{{((.((((((..,...((((((((......)))))))),,{.......)),,.)))))).}}|{|||,..})),))}}},)))))))|,,,...........,{,.,{,.,{(((({((,,..,({{.,,{|||,...,{,|||||.||}},.|||......}},..(((((..(((.(((.{((....}||.......((((({,.......}.))))))...})).)))..))))).|,..........||{||||},||{{{..((((...{{{{.|||..(((((.((((.(((.((....)).)))..)))))))))})))))),,)||||||}...|||||}}.}}}}}..,{|{{,.......}|||}}(((((...(((......)))...))))).....,.,},,}}}........,.,)))),,,}},,

Transcripts

ID Sequence Length GC content
NM_005564.5 NCBI
ACUCGCCACCUCCUCUUCCACCCCUGCCAGGCCCAGCAGCCACCACAGC… 820 nt 0.5598
Summary

This gene encodes a protein that belongs to the lipocalin family. Members of this family transport small hydrophobic molecules such as lipids, steroid hormones and retinoids. The protein encoded by this gene is a neutrophil gelatinase-associated lipocalin and plays a role in innate immunity by limiting bacterial growth as a result of sequestering iron-containing siderophores. The presence of this protein in blood and urine is an early biomarker of acute kidney injury. This protein is thought to be be involved in multiple cellular processes, including maintenance of skin homeostasis, and suppression of invasiveness and metastasis. Mice lacking this gene are more susceptible to bacterial infection than wild type mice. [provided by RefSeq, Sep 2015]

Forensic Context

A study in humans demonstrated that the LCN2 gene was up-regulated in circulating leukocytes from severely burned adults with a burn size >40% total body surface area, showing a fold change of 2.63 [Sood et al. DOI:10.0000000000000905]. In a separate study investigating ultraviolet-B-induced inflammation, the LCN2 gene was also found to be up-regulated in human skin, with a fold change of 10.7, and in rat skin, with a fold change of 14.7 [Dawes et al. DOI:10.1371/journal.pone.0093338]. A study in rats demonstrated that the LCN2 (NGAL) is a shared early biomarker of remote organ dysfunction following blast-induced extremity trauma, with its mRNA and protein levels consistently upregulated in lung, kidney, and liver tissues within 24 hours post-injury and significantly correlating with multiple organ dysfunction syndrome (MODS) activity and adverse outcomes [Rowe et al. DOI:10.3390/ijms26167794]. Serum and tissue protein levels quantified by ELISA increased progressively, with the magnitude and temporal dynamics of elevation correlating directly with trauma severity, particularly in models involving superimposed tourniquet-mediated ischemia/reperfusion injury.