Basic Information

Symbol
LCP1
RNA class
mRNA
Alias
Lymphocyte Cytosolic Protein 1 LC64P PLS2 L-PLASTIN CP64 Plastin-2 LCP-1 L-Plastin (Lymphocyte Cytosolic Protein 1) (LCP-1) (LC64P) BA139H14.1 (Lymphocyte Cytosolic Protein 1 (L-Plastin)) Lymphocyte Cytosolic Protein 1 (L-Plastin) Lymphocyte Cytosolic Protein-1 (Plasmin) Epididymis Secretory Protein Li 37 Plastin 2 L-Plastin HEL-S-37 LPL
Location (GRCh38)
Forensic tag(s)
Wound age identification Other applications

MANE select

Transcript ID
NM_002298.5
Sequence length
3643.0 nt
GC content
0.4535

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1080.00 kcal/mol
Thermodynamic ensemble
Free energy: -1150.57 kcal/mol
Frequency: 0.0000
Diversity: 984.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..............((((((((.((((..(((....)))..)))).))))..(((((((((((.......((((......)))).........(((..((((((((...(((.....)))..))))..((((((..((((((..(((((.(((....)))..)))))(((....))).))))))..))))))..(((((((((.......(((((...(((((......)))))..)))))......((((((....(((((((((((..((((((((.((((((((.(((((((...((((((((((....))))...((((((((.(((.......((((((((....((....(((((.................)))))...))))))))))....((((.(((((....((......))(((((...)))))..((((......))))....)))))))))((((((.....))))))....))).)))))))).....(((((((.(((((((((((((((((.............................)))))).))))))).))))..........(.(((((..((((.......))))...))))).)....))))))).......))))))....)))))))...(((((......)))))))))).)))))..)).)))).)))))))))))....))))))...((((((((((.((((((.((..((((.....)))).)).)))))).)).)))))))))))))))))......(((((((((((((((........))))))))......(((((.(((.((((....))))..))).)))))..(((((((((((.((((..(((...(((.(((..((((((.((((((........))))))......((((((((((......(((((.....)))))...(((.((..((((((((.(((((....((((((((....))))))))((((....)))).((((((.(((.(((((((.(((.(.((......)).).))).)))))))..((((((((((.....(((.((.....(((((((((.(((......)))..)))).))))).....))...)))...))))))))))..(((...)))..........((((.......))))))))))))).(((.....)))....(((((..((((.(..((((((((..(((((((((((...(.((((.(((.((((.((((((.(((((....(((.(((((.((...((..(((((((.......((((((.............))))))....))))))).))...)).))))).))).((...((((((((.....(((((((((((((((.((...............(((((....((.((((((((((.......((((((.((((..((((.((((..(((((((((.((((........)))))))))))))...))))))))))))..))))))....((...))....(((((.....(((.......)))......))))).((((((((((.....((((((.......(((.((((((((((((((((....(((((....)))))..(((((...((((((...(((((((((........)))..)))..)))..))))))...))))).(((((......)))))(((((...((((...((....))...))))..)))))...........))))))))))....((((...)))).....((.((((...)))).))...........)))))).))).....)))......))).....))))))))))(.(((((.....))))).)..((((.((.......))))))...)))).)))))).))...)))))....((((((((((((.(.((((((..((((((((((..(((((((((.(((.(((....))).)))))((((....))))...((((((........))))))........(((((((..((((..(((.................))).))))..))))))).)))))))..((((((......))))))......(.((((((((((.....)))))).......((((((((((((((.....((((......))))...((((.(((((((..(((((.(((((...)))))..)))))..))))).)).)))).)))))))))))))))))).)((((((....))))))...........))))))))))..))))))).))))))))))))......(((((.(((.(((......)).).))))))))..)).)))))))....))))))))))))))))....))............))))).))))))))....)).))))))).)....))))))))..(((((((((.......)))))))))((((..........)))))))..)))).))))..)..))))..)))))(((......)))))))).))).)))))..)).)))....))))))))))..)))))).))).)))...)))..)))).)))))...((((((((((((((...(((((.....................(((((((..(((((........((((.(((((.......))))))))).....((((...(((((((((((......(((((((((.....))))))))).....))))))).....))))..))))(((....))))))))...((((((.......))).)))....)))))))((((....))))..((((((.(((((.(((......))).)))))...)))))).)))))...)))))))).)))..))).....((((...((((...))))..))))...(((((....)))))(((((((((((((...........))))))........((((((((((.(((((.......))))))).......((((.........))))........................(((((.((((((((((((((((((..((.((((.((......(((.((...(((.(((.((..............((((........))))...)).))))))..)).)))....)).))))))..)))).(((((((....((((......((((((((((((((....))).....((.((((.....))))))((((.(((.((....((((.(.....).))))....))))).)))))))))))..)))).......)))))))))))....((((.((((((........)))))).)))))))).))))))))))))).))))))))))....))))))))))))))))))))....(((((....)))))(.(((((.((((....((((.(.((((....)))).).))))...))))...))))).)........)))).)))..)))))))))))..(((((......))))).....((.(((((...(((...)))...))))).))...........))))...
Thermodynamic Ensemble Prediction
((((,,,.((((((((..((((,((((..(((....)))..)))).))))..))))))))})}}.,|||||||,.,,,.,{{{,.........((,{(((((((((,,,(((.....}}}..}}}}.,(((({{..{{||||,|{((({.(({....)))..))))}|,(,...||,,|||||}.,||||||{,{{,,,,})))},,|||||{{|,..{{||{,,,,,.}|||}..}}|}..((((((..((({,,{((((((((((....((.(((((((.....((.((((((....(((((((((({(((((({{{((((((((.((({,.....((((.{{{||||{{,,,,(((((,{{,.,,,,,{{,....,..||{{{|{.|||||||{{{{(({{({.,(((((,((.,,,,{{,(((((...))))).,|{{(,,,{{{||||....,,|..,.,))}}|||..}})))}}.,....}).})||}.....})))}}|}}}},((((((((((((((((,.....,.....{{....,.,,.,,.....,))))).)))))))||)})..{{{,....,.{{|{{..{|{{,,.,,,,}}}}...}||}|.|....,}}}}},.......,..{,....||})))},{{{{((((,....,))))}..|||{{{{{{...,,,,,,}})||,}}}})}})},.,,))},..((((((((((.((((((.((..((((.....)))).)).)))))).)).)))))))){(((.(((.......))).)))|(((((((........))))))),......|||{|}|||}||{|,,,,}},}.,}||,|||))|}|||||}}}}}}}}))}}}},,,...|,,|{|,,|||||{.((((((........)))))).,....((((((((((......,{(((,..,.,||||.,,(((,((,,{((({(({.((({,....((((((((....))))))))((((....)))).,{{{{.{(({.,{|||||,{{{,|..|}}}..,))})}})),)}))}},..((((((((((.....(((.{,..((,{((((({((,({(.,....}}).,})))}.})))}}.}})}...))).,.))))))))))..(((...}}},{{{...,}||(((.......)))))}}}}}}}},(((.....|||...,{((({..((((,(..((((((({..({{((((((((...{.((((.(((.((((.((((((.(((((...{(({.(((((,((,,,({..(((({{,.,}}}..||||{{.,|,,,......,}}}}}}..,,|}}}}}),))...}}.})))).}}}.||,..((((((((.....(((((((((((((((.((...............(((((....((.((((((((((.......((((((.((((..((((.((((..(((((((({,((((........)))))))))))))...))))))))))))..)))))).,..{{...}}.,..(((((..{{,(((.......)))||....})))}.((((((((((.....{{{{{,..,....(((.((((((((((((((((..,.(((((....)))))..{((((...((((((...(({((({((........)))..))).,)}}..))))))...))))}.(((((......)))))(((((...((((.,.{,....,)...))))..)))))...........))))))))))....((((...)))).....((.((((...)))).)}...........)))))).)))..{|{|||....,})),,}...))))))))))|,|((({.....))))).}..{{{,,{{,......))))}}..,))))})))))).))...)))))....((((((((((((.(.((((((,.(((((((((({,(((((((((.(((.(((....))).)))))|(({....}))}...((((((........))))))........(((((((..((((..{{,.,...............}},.))))..))))))).}}}}}|||{(((,,,......,||}|,........,|||||||||.....)))))),}.....((((((((((((((......,,,,,,{,,|,,....{,{|}||(((((..(((((.((((,...,))))..)))))..))))),)}.,}}).)))))))))))))),,,}.,|{{{,,..,,|||,},......}}},,)))))))))),.)))))))}))))))))))))......(((({{(((.{{,,.....}).}.))))))))..}).)))))))....)))))))))))))))).,,.},.,....,,,...))))).))))))))....}).))))))).}....))))))))..(((((((((.......)))))))))((((..........))))))),.)))).))))..}.}}}))..)))))|{{....,,)},}}))).)))}}))}}|,|}.}}}.}}}))))))))))..}))))).}}).))))))))))))))))))....))))),))))....)))))))))))))))..)))))),}}}.,,....,,,)))))))).,,..{{{{{{{.,,,|||{..{|,.|||||,,...}},,.}....}}..|||||||}}}}..(((((((((.....))))))))).....||||||,,.....((((((({.(((....)))((((((.,(({(((.......))).}}}...((((((.(((((....)))))...)))))),,,,.,,|..{|||,},.||||((((({|{{,..((((.(((((,((((((({{{..,.....,|{,.,}||||}}}))}}..})},...}}}}.))))).))))..,||,||,,.,,{,........{{|||{{,{{....,,....{{((.(((((.......))))))).}},}}.|||}}}}.....}))}..........}}}}}.}}},...,}}}}}})))))).((((((((((,..(((.(.(((((...,....((,(((,.,.((((.((,,(.((({......((((........)))),{{{{{{{{(({..((((,{{.{{{{((({{({,{,,,..(((((((....((((...,,.((((((((((((((....))).....(,{((((.....)))))}{(((.({({((....((((,(.....,.}))),,..))))).))))))))))),,)))}.,,....)))))))))))...,{{((,,{{,,|}|},,..{||||||.,|||,,,,,))).,}}}}}}},..{||{{,{||,,..,{{,||||......))}))))...|{{{{....))))),}}},)}}}.}}.}))),})))))))).))}|||,.,.,.....,}}))))}))))))),.}))),),.},,...))))).),},.,,,.,))).)))))))....................})))))))....,))))})........}}}}.......

Transcripts

ID Sequence Length GC content
GCAGAUCAGAAAGAAGGGGUUCCUGGUCAUACACCAGUACUACCAAGGA… 3643 nt 0.4535
Summary

Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Sprague-Dawley rats demonstrated that the mRNA expression of the LCP1 (Lcp1) in contused skeletal muscle significantly increased at 4 hours post-injury and remained elevated within 24 hours, showing a time-dependent pattern [Li et al. DOI:10.1007/s00414-023-03095-x]. A study in mice demonstrated that lipoprotein lipase is an enzyme releasing fatty acids from triglyceride-rich lipoproteins for uptake by brown adipose tissue [Behrens et al. DOI:10.1016/j.molmet.2025.102252].