Basic Information
Symbol
LCP2
RNA class
mRNA
Alias
Lymphocyte Cytosolic Protein 2
SLP-76
SLP76
SH2 Domain-Containing Leukocyte Protein Of 76 KDa
76 KDa Tyrosine Phosphoprotein
SLP-76 Tyrosine Phosphoprotein
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein Of 76kDa)
Lymphocyte Cytosolic Protein 2 (SH2 Domain-Containing Leukocyte Protein Of 76kD)
SH2 Domain-Containing Leukocyte Protein Of 76kD
IMD81
Location (GRCh38)
5:170246233-170297820
Forensic tag(s)
Sudden cardiac death diagnosis
Postmortem interval inference
Cause of death analysis
Other applications
MANE select
Transcript ID
NM_005565.5
Sequence length
4232.0 nt
GC content
0.4381
Secondary Structure
Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1091.87 kcal/mol
Thermodynamic ensemble
Free energy:
-1170.03 kcal/mol
Frequency:
0.0000
Diversity:
1037.05
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((...))))))..(((....((((....(((((.((((.....(((((((.(((((..((((((((((.....((((.((.((((((...((((((((((......(((((((...)))))))(((((.....))))).......((((....(((((..(((.((((((((........))).)))))..).))..)))))....)))).((((...)))).........))))))))))......((.(((((..(.(((..((((((((((...(((((.(((((((((.((((((..((((((((((..((.(((((.((.(((.....))))).))))).)).))))...........)))))).......)))))))))...(((((......))))).....((..(((((.((((((.(((((.(((......))).))))).))....))))..)))))..))((((((.((....)).)))))).......)))))).)))))...((((((((((((.(.((((.((((...(((.......(((((.(((((.((..(.((((((((.....((((........))))...((((.......))))..(((..((((.............))))..)))................(((.(((((((((...(((((...(((((((...........((((....)))).....)))))))......)))))...(((.(((..........))).)))(((((((.(..(((......(((((..(((...............((....))..............((.(((((((((((((.((((....)).)).))))(((.(((((((((.(((((............(((((.(((((((.(((.......))).............))))))).)))))...)))))..)).))).))))...))))))))).))).))............((.((((((....(((....))).........)))))))).((.....((((((..........)))).))....)).))).)))))......)))..).)))..))))......)))))))))..))).....(((........)))...))))).))).)..))....))))).)))))......)))......)))))))).)..)))).)))))))).......((..((((((((((..(((((.........)))))...)))))).))))..)).....))))))).)))..))).)..).)))).))......)))))))).))))((((((.......((((((((.........((((.((...........)).)))).......(((((...))))))))))))).))))))...........((((((((((..(((((((((...........(((((((........))))))).)))).))))).........................)).)))).))))((((((.............))))))............((((((.(((((((((.........((((((.(((.((...))((((.(..((((((((((((.....((((........)))).....))))))...........(((((....(((((...(((....))).....((((..(((((((......))).)))).))))))))).((........)).)))))........)))))).).)))).))).)))))).((((((......((((((.(((((............(((..(((.((((((....(((((((((((.((((((((((((((...((((((((((((.(((.....))).)))))...............................((((.((((..(((((((........((((....))))........)))))))...))))..))))...(((((((((((((.(..(((((((((((.((((((((((.....))))))......((((((...)))))).....((((((((((.......))).)))))))...(((((((((((((((.....)))).....((((((.....)))))).....)))))))))))...)))).))))))).............(((.(((((((((((......(((((((((((((((((((.................)))))))).....))))).))))))(((((.....)))))..........))).)))))))).)))...))))..).)))))))))))))......(((((((((..........(((..(((.((((...)))).)))..))).....(((((.(((((.....)))))...))))).))))))))).....)))))))...)))))))))))))).)))).)))))))....))))))............((((((..(((((..........................)))))......)))))).........))))))............))))).)))))).....)))))).......(((((((.(.....).))))))).........(((((....))))).))))))))).)).))))))))))))))..))))))))))))....)))).)))))......))))...))).........))))....(((((((...((((.(((((((....((((((.........)))))).........................(((.....(((((.........))))).....))).....(((((((((((..(((((..(((.......))).))))).)))))))))))(((.............))).........((.(((.(((((((.(((...((((((.(((((((....((.(.((((..((.(((.((((((..(.((........)).)..))))))))).))))))).)).)))))))))))))((((((.((.((((....(((((((((((..(((((.((((((.((((((.((......(((((((..................))).)))).....)))))))).))))))......(((((.((((.(((((.....(((.(((((.((((.((.(((.(((((..((((((((....((((....))))))))))))...))))).....(((((((((.(((...((((.((((((((((.((((......(((...((((.(((((.......)))))...))))..))))))).))))))))))............((......))...))))....(((((....((.(((....))).))))))).(((((...))))).)))..)))))))))....((((....))))....(((((((((((......))))))....)))))...))))))))).))))).)))((((....))))(((((..((((((((....((((..((((((((.............(((((((((...........)))).))).))...............)))))...........)))..))))((((.(((.(((((........)))))..))).))))....(((((.....)))))))))))))..)))))))))).))))..((((((..........)))))))))))(((((..(((.((....)).)))))))).))))))))))..))))))..)))).))))))))(((.....)))((((........))))......(((((((((....(((.((((..(((((((((..(..(((((((((...........))))).))))..)...))).((((....))))......))))))..)))))))....)))).)))))(((((.....(((((((((((((...............................)))).)))))))))......)))))........(((....)))...)))))))))).)))))(((((.((((...((((((((.............))))))))))))..))))).))))))).))))..))))))).............
Thermodynamic Ensemble Prediction
((((((((((...))))))...,,....{((({,..,,|||||{{,.,,,.((((((({((({({((((((,(,(({{...((((.((.((((((,..{(((((((((.,{..{(((((((...)))))))|{{{{,....}}}}|,......((((....(((((..(((.((((((((........))).)))))..).))..)))))....)))).((((...)))).........)))))))))}......((.(((({..{.(((..((((((((((...(((((.(((((((((,(((((({.((((((((((..{(.(((((.(,{(((.....))))).))))).},.))))...........))))))...}}}.,})))})),...(((((......))))).....{,..(((((.((((((.(((((.(((......))).))))).))....))))..))))).,||((((((.((,...}),))))))},....})))))).)))))...((((((((((((.{.((((.((((.{{,((.......{((((.(((((,(((..,(((({{,{....,||||.....,.,))}}...{{{{.......}})),.(({..((((...........,.))))..})),,}}}}.,........(((.((((((((({..(((((...(((((((...........((((....)))),....)))))))...}..)))))...{((.(((..{....}..))).))}((({(((.{..(((,,....(((({..,,................((,,..)).,............((,,{,((((((((((.((((....)).}).)))}(((.(((((((((.(((((.......,....(({((.{{({{{{.{{{.......})}..,{.........})))))}.}})))...)))}},.)).))),,)))...))))))))).}}}.,,............({{((((((..,.(((....)))........,)))))))}.}}...||}|,{||}.......,.}|}|{|{....)))))).)))))....}.)))..|.)})..}}}}.....,)))))))))..))).....{((........))}...}}}}}.,}).)},,,....,})))}))))}......,}}....,,)))))))).}..)))).)))))))).......((..((((((((((..((((,...,....,)))))...))))))},)))..)).....))))))).)))..))).}..).}))).)).....,)))))))).)))),({....,,..}}}|{|,|||}},.....,{(((|{|.{{{,{{....|,|||||..|,,..{((({...})))}||||||||.||||||..........{{,,{,{((((({{(((({(((,.,........(((((((........))))))).}))).))))},.........................{,{{{|.|(((((((((...........,,))))))),)}|,,,{{.,{{{{.,.{((({((((.,{,,..{.{{{{|{.|||,,|,,,}}{{{|,|..||||||{{{{{{,,.,|(((({......,)))).,,..))))))..,,,,,,}|}|||{{...,}||||.....}}},|}}},,,,.||||.|{({{{,,....||}}|,||||{||,,,},||,{{,,{..,,,|}.||||}...,....}}}}}}.}.}})},|}}.}}}}}}.{((({{..,...((((((.({(((,..........,{{{..{,..((((((....(((((((((((.{(((((((((((((...(((((({{((((.(((.....|||,|}}}}..........,.,,......,,,..,{,,,.{{((,((((,.(((((((........((((....))))........)))))))...,,,}..}}},...{(((((((((((({({.((({{((((((.((((((((({.....,||}}|,{{.....||||.,}}.,|||{{,..{{(((({{{(.......})).)))})))...{{((((({{{{,{((.....}))}.....((((((.....)))))).....}}}}))}}}}),,.)))).))))))}.............(((.(((((((((((......{{((((,{{{{{{{{{{{{.......,,,,,}..,.}}}}}}},...,,}))}}.|{{{{.(((((.....))))),)))},....))).)))))))).)))...))))))),})))))))))))}......{((((((({.......,..(((..(((.((((...)))).)))..)))....,((({{.{{{{{.....)}))}...))))).))))))))),....)))))))...)))))))))))))}.)))).)))))))....)))))).,{....,,,..((((((..({(((..........................}}}})......}))))).........,,,|}}............}}))).))}))).....}}}}}}.......(((((((.(.....).)))))))....,.,,.{{{{{.,.,))})).}}}}}}}}}.,,.)}}}}})}))},))}}}}))})))))}.,,}}))))})}}))),....,})).,.,,,..,,.,..,}}}}....(((((((.{,((((.(((((((....((((((.........)))))).........................(((.....(((((.,.....,,))))).....)))...,{(((((((((({..(((((..(((.......}}}.))))).)))))))))))||,...........,,}},........{((.(((.(((((({.(((...((((((.(((((((....((.(.((((,.{{.(((.((((((..(.((........)).)..))))))))).})))))).)).)))))))))))))((((((.{(.{{((....(((((((((((..(((((.((((((.((((((.((......(((((((..................))),}))).....)))))))).)))))).......,((({(({...{({({,,..(((.(({{(,((((.{,.((,.(((((..((((((((.{{.{{{,....,)),))))))))...)))))...,,||||||||{.||{....{{{.((((((((((.((((.,,...{||...{{{{.{(((({{{,...}}}}).,}))))},)},)))).))))))))))..,,,.......,,.....,}},,,,,{{{({{({{{{.{{{{,..,,.{{{|||.,,...,..{{{{{...,}}}}.))),,)}}}}}))).,}}|||},,,}||||,,,.({(((({{{{{...,,,)))))}.,,,))))),.,}})}}}}}}.}}}}}.|||{{((({..({{..,,,},,}))).}}|,,....,,}}},,||,||...}}}}}}}...(((((((((...........)))).))).))........(((((((((({....{{......{{(((({(.((((.(((.(((((........)))))..))).))))...,(((((.....)))))}.{{{{...,)))...,,))))),)}}.....}}..,.))))))))))),,,,.(((((..(((.({....)).)))))))).))))))))))..))))))..)))),}}))))))(((.....)))((((.,....,.))))...,,.(((((((((....(((.((((..(((((((((.....(((((((({...........}}))),}))).,)...))).((((....))))......))))))..)))))))....)))).))))){||{{.....((((((((((((((((.{,,................}}}.}}},)))).)))))))))......)))))........(((....)))...))}))))))).)))))|((((..,{,.,.((((((((.............)))))))),),,..))))}.))))))).)))),.))))))),,,......}}}.
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGAUCUGGCUACGCCAGAAAAGACAUCGGCUCCAACAGGGGUGUUCCA… | 4232 nt | 0.4381 |
Summary
This gene encodes an adapter protein that acts as a substrate of the T cell antigen receptor (TCR)-activated protein tyrosine kinase pathway. The encoded protein associates with growth factor receptor bound protein 2, and is thought to play a role TCR-mediated intracellular signal transduction. A similar protein in mouse plays a role in normal T-cell development and activation. Mice lacking this gene show subcutaneous and intraperitoneal fetal hemorrhaging, dysfunctional platelets and impaired viability. [provided by RefSeq, Nov 2016]
Forensic Context
A study in the forensically important blow fly *Aldrichina grahami* demonstrated that the LCP2 is involved in cold tolerance, showing strong relationships in gene co-expression networks at 4°C and being validated as a differentially expressed gene with expression changes in larvae [Liu et al. DOI:10.1186/s12864-020-6509-0]. In porcine skin, research on bromine vapor exposure found the LCP2 was significantly increased, with a 4.22-fold change after a 10-minute exposure and a 2.89-fold change after 20 minutes, identifying it as a component within significantly altered signaling pathways [Rogers et al. DOI:10.1002/jbt.20383]. A study in mice demonstrated that the LCP2 (Lcp2) is a key hub gene significantly associated with acute myocardial infarction (AMI), where its expression was downregulated in infarcted left ventricular tissues and external validation showed it had good predictive ability for AMI diagnosis with an Area Under the Curve (AUC) >0.8 [Wu et al. DOI:10.1016/j.ygeno.2023.110701]. Concurrently, research on postmortem transcriptome dynamics in mice found that the LCP2 transcript increased in relative abundance within 1 hour postmortem, classifying it within immunity and cancer-related functional categories of genes that become more abundant after death [Pozhitkov et al. DOI:10.1098/rsob.160267].