Basic Information

Symbol
LDB3
RNA class
mRNA
Alias
LIM Domain Binding 3 ZASP KIAA0613 PDLIM6 Cardiomyopathy, Dilated 1C (Autosomal Dominant) Z-Band Alternatively Spliced PDZ-Motif Protein LIM Domain-Binding Protein 3 Protein Cypher Cypher Oracle CMD1C Z-Band Alternatively Spliced PDZ Motif Protein PDZ And LIM Domain 6 LDB3Z1 LDB3Z4 CMD2L CMH24 CMPD3 LVNC3 MFM4
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_007078.3
Sequence length
5363.0 nt
GC content
0.5171

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1843.23 kcal/mol
Thermodynamic ensemble
Free energy: -1937.52 kcal/mol
Frequency: 0.0000
Diversity: 1236.47
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......(((((((....)).)))))..(((..((((((((((((((.(((.(((((..(.((((((.((.((((((....)).))))....((.((.((((((.((((((..(((..(((((.((.((..((((.((((((((.(........).))))))))..........((......))..))))...)).))))))).))).)))))).)))))).)))).(((((((((......((.(((......))).)).(((((...((((....))))....((.((((((.((.......))))))))..))....((((((........(((((................))).)).......((((((((...(((..((((((....))))).)..)))....).)))))))..(((((((...((((.(((.....)))))))....((((((((((((.((....)).....(((((....((.(((.(((....)))..))))))))))......)))))).))))))...((((((((....((((((.....(((((..(((.((((((..(((..((((........))))..))).)))))))))....((((((.....(((((....))))).......))))))...................(((((((.((((((((.(.((...(((((...((((((..((...))..))))))(((((((.....)))))))....((.(((((....)))))))))))).....)).).)))))).)))))).)))..............((((.(.....).)))).......))))).....))))))..))))))))...))))))).......))))))..((((..((((..(((((((.(((........))).))).................))))..))))....)))).)))))..............((((((....))))))........)))))))))...)).)))))))..))))))))(((.....)))(((((((.....)).)))))...((((....))))......)))))))).((((((....(((((((((((((....(((....))).....(((((((..(((((..(((((...)))))...........((((.((((((.(...((.((((.(((((((((.(((((.((((.((((.((((......(((((((...........((((((((......(((..((((..(((.............))).))))..))).......))))))))....)))))))........))))))))............((.((((((.(.((((......(((((.(((...(((((((.....((((..((.((((((...........(((((((((.((((((....(((....(((.((((((..........(((((......((((.((((((((((((((...((...(((((((.......((((((((((((..((..(((((((...)))))))..((((.((((((.(((((.................(((((.((...((((((((...))))...)))).)))))))....))))).....)))))).))))(((((..((((((((((.((........))...)))))((...)).)))))))))).......)).)))))))))))).......)))))))))..)))))......(((((..((((...))))...)))))..((((....((((((.((((......))))..).))))).))))((((.((((((...)))))).))))....((((....))))))))))))).)))).)))))............))))))......((((.(((.....((((((..((((.......))))..))))))..))).))))...(((((((.((((((((((((((((....)))))).(((...)))........((((((.........))).))).((((...))))...)))))....)))))...)))))))(((...............)))(((((((.(((.(((((.(((...(((.......)))..)))))))).))).......((((((.(((.((((......)))))).).).)))))((((.....))))(((((...............((((((....)))))))))))......)))))))(((.((....)).)))........)))....))))))))).))))........))))).)))))).)).))))..((......))......(((((((((((((((.........((((....))))..((((....))))......((((((........(((....)))........))))))............))))))))))))))).......))).))))............(((....)))(((((........))))).(((((((((.....)))))))))....))).)))))((((.((...((((.((((((.(((((.......)))))..(((((........)))))((((((.........((((((((...((((....))))...))))))))..(.(((.(((((((.......))))))).))).)....(((((((((.........)))))).)))..(((((.((....)).)))))((.......))(((((((((((((((((((((((..((((((((((((((((((((((((((.(((((((((((.....))).((((((.((((.......))))))))))(((((((((((((...((((..((...(((((((((...(.((((.......)))).)...)))))).)))..(((((((..((((((.((((.(((((.(((((......(((.((((((..((((((((((((....))))))))))))....((((((.(.(((((.....(((((((........)))))))(((((((........))))))).......((((((((..((((((.((...(((...))).....))...))))))..))))))))..))))).).)).)))).)))))).)))(((((((....)))))))....((((((((((.((((((((....(((((((((((((.((((((((((((......))((.(((((.((((((((..(((....)))...(((((((..((((.((........)))))).)))))))..))))))))((((.((.((.(((((.(((((((((((((((((....((((.((((...((....))....))))...))))..)))))))))((((((..........)))))).(((.....)))......)))))))).).)))))).)).))))...((((((((((..(((((.....(((((((...(.....)...)))))))))))))))))))))).))))).))..((.((((..(((((((((...........))))))))))))).))((((((((((..((((.....((((((.......))))))((((((...((((.(((.......)))))))...)))))))))).((.((((((((.(((....)))...)))))))).))....))))))).))).)))))))))).....)))))))))))))...))))))))....(((((.(((((((...))))))).))))).))))))))))..)))))))))).))))..))))))............((((((((((((.((.((((((.((..((((((((........)))))))).(((((.........)))))..((.....))..))..)))))).)).))).......)))))))))))))))))).))))...)))))))))))))..)))))))).((.((((((((((.......(((((.((((((......))))))..).)))).(((((.((((((((..((.((((.(((.(.(((((......(((((....((((((...))))))...)))))..))))).).)))))).).)).)))))))))))))..))))))))))))..........(((((((.....(((((((((((.(.((((.(...............).))))))))..)))))))).......((((((((((((((.(((((........................................................))))).))))))))))))))...............((((((((((......))))))))))))))))).......(((((((((......))))))))).)))..))).))))).(((((................))))).........................(((........)))........))))))))...)))))))...)))))...)).))))).)))))))))))(((((((.((((.((((...)))).))))((((((...(((((.(((......))))))))..))))))..........(((((((((((.(((....((((......)))))))))))))))))))))))))................)))))))))))).))))..))))))...(((((....))))))))).).)))))).)).(((((...(((((((.(((...)))...))))))).....)))))..............................))))..)))))))))))))).).))).))...).)))))))))).))))).))))))).((....))....))))))))))))).))))))))))).)....)))..(((((((((..((((.....))))......(((((((((((((((..............................))))))))))))))).((..(((.((((((.......)))))))))..))((((((((..((((...........))))..))))))))((((....)))).((((((...(((((((((......((..((((((((....))))))))..))((((((((((((((((((((((((.......)))))))..........)))))).....))).)))))))))))))))))...))))))))).)))))).....
Thermodynamic Ensemble Prediction
.......((((((({...,)})))))..(((((..((((((((((.,.(((.(((....(.((.((((((((.,,(((({.(({((,|{{,.,(.((.((((((.((((((..(((..((((((((.((.,((((.((((((((.(........).))))))))..........((.,....||.|)})),..)).)))))}).))}.)))))).)))))),)))|{(((((({({.,,,,,||.|||,.....}})}))}}}}.....((((....)))).....{.({{{((,{(...,...},}}}}||,|.,....{(((((........(((((................))).)}.......(((((((.,,.(((...(((((....))))).),.))}....}.)))))))..{{{((((.(,((((.(((.....))))))),...((((((((((((.({{.,{||..,}.,|||.....((,({{.(((,...}}}..,)}}}})))}.},,,.))))))},))))}...({((((((..,.((((((.....(((((,,{{{.{|||||.,(((..((((........))))..))),))))))))}....((((((.,...(((((....)))))...,...))))))...................(((((((.((((((({,(.,({{.((((({..((((((..((...))..)))))){((((((.....))))))}....{{.(((((....)))))}))))))....,))..})))))).)))))).)))......{{{,.,,.((((.(.....}.)))),|,....}}}}|.....|}||}}|.}|}|||}}..,))))))).,.....))))}),,|.}}}},..,||||,|}}}},..,}}}).}}))},,,}..,{{,(,(,.,,...|,}}}}|,,.,.})}}},..))))..})}}..,...})}))))))...))))),...))))..)))).)).,...,),)))))))..,,))))))))))....)))||{{{,.,,,,.,|.((((((..((((....))))...))))))|{{|{,((((({....(((((((((((((....(({....)}|,,,.{(((((((..(((((..(((((...)))))...........((((.((((((.,...((.((((.((((((({({(((((.((((.{(((.((((......(((((((.......,...((((((((......(((..((({..(((.............))).))))..))).......))))))))....}))))))........)))))))}............((.((((((.(.((({......(((((.(((...(((((((.....((((..((.((((((......,,...(((((((((.((((((...,{{,....,,{,,...............,{{{{({{.,|||(((..((((((((((.((.(((.(((((((((((.({{{({((((((((((..{{..(((((((...))))))}..((((.((((((.({{{(,,{{..........,..(((((.((...((((((((...))))...)))).)))))))...,))))}.....)))))).))))(((((..{(((((((((.((........))...)))))((...)).)))))))))).......},.))))))))))|((((({..||||.,}}}))))))}({.((((((((.,,{,{{{{{,||{.,,||||....,,.....,,,,,.||||.}.}}},)))}}|,||.,,.|{|,((((.((((((...)))))).))))..|.((((....)))).},}}}||)}))))}),)).....,,......}}((((((({..((((.(((.((..((((((..((((.......))))..)))))).,{{|.|,,....,}}}....(((..{..((((((((....)))))).)).,..)))....,,.,{{.,({.........})),}}}.((((...)))))).))))))})))))))))))))))))))|,{,,,{{,..,,,.,|||{{{|||{.{{|,{((((,{{{...{(({{{...,||||||||||||}.}}}..,,|||((((({.,{{.|||{..,...)))})).),),)}}))||||,.,,,)))}|,,,........,,,,))}(((((((....)))))))}|}},,,,.})))))).))..))))))))))..))).,,..)))....))))))))).)))},,....}}))))}.)))))).)).))))..((......)}.,,{,,((((((((((({{{({{{{{.,,,((((....})}}..{(((....)))}.{,...{(({{(,.,,....{{{.,,.}}),,.,,...||||||........,,}}))))))))))))))),,,....})).))))..,,....,.,,{,,...,}||(((((........))))).(((((((((.....)))))))))...,))).)))))((((.((.{.((((.((((((.(((((,....|.))))).}(((((.|....,.)))))((((((.........((((((((...((((....))))...)))))))}..{.(((.(((((((.,...,.))))))).))),|...||{{{{((((,,,,.....}|||||,,,..|(((((.((....}}.})))}|,|}},,|||}{((((((((((((((((((((((..((((((((((((((((((((((((((((((,,,,,.}}}}))},,,.((((((.((((,{....}))))))))))(((((((((((((...((((..((,..(((((((((...{.((((.......)))).,.,.)))))).)))..{((((({..((((((.((((.(((((.(((({......{((.((((({..((((((((((({....))))))))))))..{.({(({(.(.(((({.....{((((((........)))))))|((((((........))))))),,,....((((((((..((((((.({,..{(,...,)}.....,}...))))))..)))))))).}))))),),)).))))})))))).))}(((((((....))))))),{{..(((((((((.((((((((.,,.(((((((((((((.((((((((((((.....,||({.(((((.((((((({..(((....}}}...(((((((..((((.((........}})))).))))))).,))))))))((((.((.((.(((({,(((((((({((((((((....((((.((((...{{....}}....))))...))))..))))))))|((((((..........)))))),(((.....)))......)))))))).).)))))).)).))))...{(((((((((..(((({....,(((((((..,{....})...)))))))))))))))))))))}.))))).)),,{{.((((..(((((((((..,........))))))))))))).}}((((((((((..{{{{.....((((((.......))))))((((((...((((.(({,{....})))))))...))))))}}},.((.((((((((.(((....)))...)))))))).))....))))))).))).)))))))))).....))))))))))))).,.))))))))....{{{{{.{{(((({...|}}))}).}}})}.))))))))))}}}))))))))).))))..)))))}.,.,.,{{,.{{(({{{(((((((.,,.,|||||}}|..((((((((........)))))))).(({({..,,.....,}}}}..((.....))...,.,,|||||.,,})))),..,}})))))},},})))))))).))))...)))))))))))))..,,}||||,.{(.((((((((((.......(((((.((((((......))))))..).)))).(((((.((((((((..,,,((((.(((,(,(((({.....,(((((.{{.((((((...)))))).}})))))}.)}}}),),)))))).),)),)))))))))))))..)))))))))))}..........,,,,,,......(((((((({{{{(.((((.(...............).)))))))}..))))))))}......((((((((((((((.(((((........................................................))))).)))))))))))))).............,.((((((((((......)))))))))),}})},,.......(((((((((......)))))))))...},,))).))))).{((((................))))}.........................(((........)))........,)))))))...)))))))...)))))...)).))))).))))))))))){|{|{|||((({.{(((.,,)})}.))}},,{{{{...{{(((.(({......}}}})}}}..,,,,,...........|||||(||||{.{{{...,({{{...|,..,,,)))))))}}}}}}}})))}}}........,.,,....)))))))))))).))))..))))))...(((({....,)))))))).).)))))).)).(((((...(((((((.,,{,,..,,,,.)))))))..,..)))))..............................))))..)))))))))))))).)},)).))...,.)))))))))).))))).)))))))..,...})}....))))))))))))),)))))).||.|,|....|||..|||||{|||.,|,||}}},.||)}||,|..(((((((((((((((..............................))))))))))))))).((..(((.((((((.......)))))))))..)){{{(({{{.|{(((,...,,..,{.||||,.,,,))))).||{,,,.}}))||{{||{...,,,,(({{{{{{{{{({..{{{{{{{(,,,,||||||}}.((((.....|||},{(((,({,,,..,.,}},,}}}|||||..,|{{{||..},|||.},,})))}}},.,}))))))})))))..})))))))}.}}))),.....

Transcripts

ID Sequence Length GC content
CCCCAGAGGCGAGCUUCAUCAGGCAGGAGCCAGAGGCCAGAGAGACAGC… 1612 nt 0.5887
AUUCUUAGGAGCCUCUCAAGAGCUCCACGCAGCCCGGCUGGGCAGCAAG… 5363 nt 0.5171
Showing 11 to 12 of 12 entries
Summary

This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]

Forensic Context

A study in a human patient demonstrated that RNA sequencing of cardiac and skeletal muscle revealed abnormal splicing of the LDB3, specifically the pathogenic inclusion of exon 11, which served as a molecular diagnostic marker for genetically confirmed myotonic dystrophy type 1 and was implicated as a potential mechanism in a case of sudden cardiac death [Yamamoto et al. DOI:10.1016/j.forsciint.2019.109906].