Basic Information

Symbol
APBB1IP
RNA class
mRNA
Alias
Amyloid Beta Precursor Protein Binding Family B Member 1 Interacting Protein RIAM INAG1 Amyloid Beta A4 Precursor Protein-Binding Family B Member 1-Interacting Protein Retinoic Acid-Responsive Proline-Rich Protein 1 Rap1-GTP-Interacting Adaptor Molecule Rap1-GTP-Interacting Adapter Molecule APBB1-Interacting Protein 1 Proline-Rich Protein 73 PREL-1 RARP-1 PREL1 RARP1 Amyloid Beta (A4) Precursor Protein-Binding, Family B, Member 1 Interacting Protein MLLT10/APBB1IP Reciprocal Fusion Protein Rap1-Interacting Adaptor Molecule MLLT10/APBB1IP Reciprocal Fusion Proline Rich EVH1 Ligand 1 Proline-Rich EVH1 Ligand 1
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_019043.4
Sequence length
2633.0 nt
GC content
0.5268

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-838.30 kcal/mol
Thermodynamic ensemble
Free energy: -888.99 kcal/mol
Frequency: 0.0000
Diversity: 708.72
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((.(((((.(((..(((((((((......((((.....((((.((((((.(((((...((((((....(((..(.(.(((.(((......))))))).)..)))...))))))....))))))))))).))))..((((((((......))((...(((((((((((((.(((..(((.(((((.(..((.(((((....((((((.((((((.....((.(((.(((((....)))))))).)))))))).))))))..)))))))..).))))))))...)))))))))))...)))))...)).....(((((((((.(((((..(((((.......))).))..))))).)))(((((((.((...(((((((........)))))))....))))))))).................))))))))))))......)))).....)))))))))..))).((((((((.(((.((((((..((((((...(((((..(((((...(((.(((((.((((.(((((((....((.((.((((((((.(((((..................))))))))..............))))).)).))....((((((........)))))).((((((((((((((.((.......(((((((((((((.((((((......(((.(((((((((((.(((((..(((....(((.(((((((..(((((.((............((((((.........)))))))).))))).((((........))))............))))))).)))....)))..)))))....)))....))).))))).)))..((((...............)))).......)))))).))).)).))))))))..((((((((((((.(.((((((.((((((.(....((((((((....)))))).))......(((((((.(((((((.(.((...........)).)))))))).)))))))).)))))).)))))).)((((((..(((.((((((((((..((((((((............(((((......(((.((((((...(((..............))).)))))).)))......)))))...........((((......................))))............(((((....)))))...)))))))).........)).)))).))))..)))..((((((((......(((((((((((((........(((.....)))..))))))))))))).))))))))...............((....)).))))))..)))))))))......)))(((((...((((((..(((((((....)))))....((((((((.((.................)).....((((....(((((((...))))))).........))))...))))))))..............)).))))))..)))))......)).))))).(((((.(.((((.....((.(((....(((.((((....))))))).....))))).((((((.(((((..(((((((((((((((((.((.(((((.(((((((..(.((..(((((((((...)))))..).)))..)).)..)))).....(((........))).....((((((.................)))))))))..))))).)).)))))(((.(((....(((.....(((....)))....))).....))))))..............(((...)))..((((.......)))).))))))))))))......((((.....(((((((((...))))).)))).((((.....))))...(((......)))...))))...((((((((((((..((.(......((((.(((.(((((((.((.((.((....)).)).))..((((.......))))....((.((.((....(((....(((((((.(.......).)))))))...)))....)).)).))...))))))))))))))....).)).))))))))))))...))))).)))))).)))).))))))(((((((.((..(((((((.(((((((......))))))).....(((((.((.......)).)))))...........(((...))))))))))..)).))))))).(((((.(((((((........)))))))..))))).....))))))))).((.(((.((.(((...(((..((((..(.((((...)))).)..)))))))...))).)).))).))))))))).))))))))).))))))))..(((((((..(.(((((((..(((((((.........(((((((..((......((((........(((.(....).))).........))))....))..)))))))))))))).))))))).)..)))))))....)))))..)))))).(((......))))).)))).)))))))))))((((((((((((....)))))..))))))).......))))).))))).
Thermodynamic Ensemble Prediction
....(((((.(((((.{{{..(((((((({..,.,,{(((.....((((.((((((.(((((...((((((....(((..(.(.(((.(((......))))))).)..)))...))))))....))))))))))).)))).,((((((((,..,,.||,{.,.(((((((((((((.(((..(((.(((((.(..((.((((({...((((((.((((((.....((.{,(((((((....)))))))),)))))))).))))))..)))))))..).))))))))...)))))))))))...))))).|,||.,...(((((((((.(((((..(((((.......))))}}..))))).)))(((((((.((...(((((((({...})})))))))....))))))))).................))))))))))))......}}}}..).,))))))))}..|||.((((((({.{{{.|{{{((..((((((...(((((..(((((...(((.(((({{((((.(((((({....,(,((,((((((({{(((((..,,........,.....)))))))).,............))))).,),),....((((((........)))))).(((((((((((({,.((,,,....|||{{((|{,,{({{{,{||},,...,(({(,((,,,,,,|}||||,..{||,,{{((({(((({,(,{,(((({,({{{,...,,.,.((((((.........)))))),).)),},.((((........))))...........,}))))),}))),...,,,..||,||{...|||...{.{{{|||||{||,{{(,((...,...,,,,....},,,...,,,,}}},||{|||.||.|||||,||.{({,(((((((((.(,({({{(,((((((,{....||{(((((....})))}},||..,,{.(((((((.(((((((.{.{{,.........,}}.}))))))).)))))))},}}}}}).)}||||.,((((({..{{|,||{||||{{{..((((((({........,,.{(((({{,{...{((,{,{{{{.,.{{{|,|||.........}}}.,|||||.|||{.....))),)},,........{{{{,{....||..............)))}............|||||.,,,,)))),,,)))))))).....}},.,}.)))).))))..}))}.((((((((......(((((((((((((........(((.....)))..))))))))))))).)))))))){{.............,|,...}}.}})}))..))))))))).|...{((.((((((((((,,,{{{{,..,,({{..{{{.,...}||,|||,,..,.,.,,,}}...}}}}}}))}}}}},,|,....(((((({...})))))).........,|,,.,{||||||||{{,{{{{,,{{{..,,}))}||}}}}})}}..,..{||.},}}}.,{|||}|.{|||....,((.{{{....,{{|((({....))})}})}....}}})).{{((((.(,(((,.(((((((((((({{{{{.((,(({{,..(((((((({,((,..{(,(((((...))))),,}|{.......||.|||.....,||{.....,,,}}}...}}|{,,||.}}},,,}}........}}})),.}}},))))).)),))}|||{(.({(...,(((,....{((....)))....,}},,|,.}}}(((.....||.,,...,|||.}}}}}}.||||,,,},.,)}},.))))))))))))(({{{,{{{,,,,..(((((((((...))))).)))).({(({....}}))}..(((,.....}}}...))))...||{|||||||||.,||,|}}}}..{{{|.{{{.|||||||}||.||}||}},}))})}.)).}}}.}}}}}}...}}|||||.}}}.,,|}}.,}||....{{{||||,{.......}.}}}}|}|,..},|{....)}.)}},.)))))))))))|||||{...|.||.||}}}}||,||},,.))})).)}}}))}))}).))))))(((((((.((..(((((((.(({{(((,.....||}||||....||}|((|{.((((......}.)))).}.}..,}}.|||,..))})))))))..)).))))))).(((((.(((((((........))))))).,))))).....})))))))).,(,(((,(,.{{{..}|||,}|{{{.,(,((({...|||}.,,,|}}})))..,))),)),))}.))))))))).))))))))).)))))))).,{{(((((.,(.(((((((..(((((((,,..{{.{{((,(((((....,|}},{{||...,,.......}}}},)}),,,,{,...}}))|.....,},,,,,,,,}))))))).))))))).,..))))))),...}))))..)))))}.{{{,,,,,,|||}}.)))),))))))))))}((((((((((({....}))))..))))))).......))))).))))).

Transcripts

ID Sequence Length GC content
AGUCUUUGGUGGAACCAUCACUAGGCCCCAAUCCCUUAGUCCCUCUUGC… 2633 nt 0.5268
Summary

Predicted to be involved in signal transduction. Predicted to act upstream of or within T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell and positive regulation of cell adhesion. Located in cytosol and plasma membrane. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in C57BL/6J mice demonstrated that the mRNA Apbb1ip was identified as a differentially expressed transcript in cardiac tissue during chronic intermittent hypoxia-exaggerated post-myocardial infarction remodeling, where it was positively correlated with the lncRNA Mirt1 in a co-expression network analysis [Wang et al. DOI:10.3389/fgene.2022.818823].