| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACCCAGCUGCCUGAGACCCUCCUUCAACCUCCCUAGAGGACAGCCCC… | 1917 nt | 0.5842 | |
| ACACCCAGCUGCCUGAGACCCUCCUUCAACCUCCCUAGAGGACAGCCCC… | 2019 nt | 0.5899 |
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which plays a role in left-right asymmetry determination of organ systems during development. The protein may also play a role in endometrial bleeding. Mutations in this gene have been associated with left-right axis malformations, particularly in the heart and lungs. Some types of infertility have been associated with dysregulated expression of this gene in the endometrium. This gene is closely linked to both a related family member and a related pseudogene. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
A study in humans demonstrated that the LEFTY2 mRNA, evaluated via RT-qPCR, is a specific marker for identifying menstrual blood, with a proposed cutoff ΔCq value of >7 successfully discriminating it from peripheral blood and other forensically relevant body fluids, though it showed cross-reactivity in 2 of 8 semen samples and its expression varied during the menstrual cycle [Akutsu et al. DOI:10.1007/s00414-024-03199-y]. The LEFTY2 was also noted as a menstrual blood-specific mRNA marker in a collaborative exercise evaluating RNA/DNA co-extraction for body fluid identification [Haas et al. DOI:10.1016/j.fsigen.2015.01.002]. Another human study developing a heptaplex mRNA profiling method mentioned the LEFTY2 as a previously described menstrual blood marker but did not experimentally study it within its own validation [Jakubowska et al. DOI:10.1016/j.fsigen.2014.07.006].