Basic Information

Symbol
LEP
RNA class
mRNA
Alias
Leptin OBS OB Leptin (Murine Obesity Homolog) Leptin (Obesity Homolog, Mouse) Obesity Factor Obese Protein Obese, Mouse, Homolog Of LEPD
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000230.3
Sequence length
3427.0 nt
GC content
0.5022

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1310.30 kcal/mol
Thermodynamic ensemble
Free energy: -1366.05 kcal/mol
Frequency: 0.0000
Diversity: 706.07
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((.......)))))).((((((((......((((...)))).(((((..(((((.(((...))).)))))..)))))((((((((.(((((.((((((((.(((((..(((((((.(((.............(((((...........)))))..(((....))).((((((....((((..............))))......(((((((.(........).)))))))......))))))(((((((.(((((.((........)).))))).((((...)))).....((((..((..(((.((((((...(((((((((..((((((..............(((((((((...))))))).))....))))))...(((((.(((..((.((((((((((...(((((..((((((((((((.((..(((((.((....)).))))).))...)))))))))))))).))))))))))))).))))).)))))(((((..((((((((((.(((((.(((((....((.((((((((....).)))))))))......)))))(((((((..((.(....).))..)))))))..((((....(((.((.....)).)))....))))....))))).(((.(((((((......((((.((((.(((((((((((((((..(((...........)))...(((((((((((((((((((.(((.......)))...........(((((((.((((.....)))).))))))).((((........))))...((((((((..((.((((((((.((((.(((....((((((....))))))(((((((.(.(((.(((((((((((((((.....)))..))))...))))........)))))))))))))))..))).((((((((((....)))....))))))).(((((((.((((....))))((((((((((((((.(((......((((((....(((((.......)))))((((....)))).....)))))).((((((((((((((((((((((((((((((.((((((((((((((((((((((((((((((((((((((((.((((((((.((((((...((...((((....))))....(((.((.(((((((((((((((...)))))))..)))))))).)).))).(((((((.(...).)))))))(((((((.........))))))).........((((((((.((......))))))))))...(((((...)))))((((..(((....))).....))))...........(.(((((......))))).)........))...))))))))))))(((((((((((((..(((((((((((((.(((((......(.(((((.((((..((((.....)))).))))...))))).)...))))).))))))...))))))).........))))))))))))).........((((((.(((((((.((..(((...)))..))))))))).)))))))))))))))))))))))))))))))))))))))))))))))).)))))))))))))))))))))))))))))).(((((.((((...)))).)))))...((((((((.((((....))))...)).)))))).))).)))))))......))))))).((.((((((((...))).)))))))...)))))))..)))).)))))))).)))))((((((((.((((((((.......))))))))...((((((((((((((((((.....)))))..)).)))))...))))))((......))..(((((.((((((...((.........))......)))))))))))....(((((((((.((((...((((.((((((((((((((....))))......)).)))))))).))))(((.((.....)).)))..(((((......))))))))))))))))))....)))))))).))))).))))))))))))))))))).(((((((((.((((.((((..........))))))))))))))))).......((((....))))........(((((........)))))(((....)))......((((((((..((((.(((((((.((((.........((((((..........)))).))(((((((((((..((((((..(((...(((((.(((((.(((((((....)))....)))).))).)).)))))....((((..((((....((((...)))))))).)))).((((((..((((((.(((((((((...(((((((.(((((.(((...)))..)))))...))))...((((.....)))).......))).))))))))).))))))..)).)))).....))).))))))..)))))...................................(((....))))))))).))))..)))))))))))...(((((.....)))))((((((.((...)).)))))))))).))))..((((((((........))))))))...)))))))))...)))..))).)))).))))))))))).)))......))))))))))....)))))....)))))))))))))))...)))..))....))))...))).)))).))).).))))))..).)))).....))))))))....))))).))))))))......))).)))))..((((((((((((((.(((((...(((((((..(.((((...(((....)))...)))).)(((((((((((((((((....(.(((((..........))))).))))))............((((((((....))).)))))((((....)))).)))))).).))))))))))))...))))).))))))).((((.....((((..((((..(((((((((((..............))))).((((((((((((((((.(.(((((((.(((((..((((((((....))))))))..))))).)))...(((((((.((((.((....)).)))).).)))))).(((.((.(((..((((...........))))..))))).)))))))(((.((((((.((((.(((.((((((((((.((..(....)..))))))...)))))).))))).)).))))).).)))......).)))))))))).)))))).....))))))..)))).))))))))..................(((((((............))))))).....))))))))))))
Thermodynamic Ensemble Prediction
(((((((((((.......)))))),((((((((.....{(((,,,,||},.(((({..(((((.(((...))).)))))..))))){{((({{,.|||((.((((((((.(((((..(((((({.{,,.......(((...(((((...........)))))..))).,{(((((({...(((..((.((((((.(((((((......{{{(.(((((((.(........}.)))))))(((((.(((((({....,,,(((((.((........)).))))).((((...))))..{{{{......||||{,,..((((....((((((...((((((.{,,...........(((((((((...))))))).)).......{.(((.(((((.(((..{(.((((((((((...(((((..((((((((((((.((..(((((.((....)).))))).))...)))))))))))))),}}}}))))))))),)}))).))))}}||,},{{{{,(((((({...{..(((((..,.((.(((((((,....}.)))))))))..,...))))).,.})))))).)))}))))))...))))))....)))).....,)),,,,))))))).))))).(((..(((...(((.(((((((({.{(((((({.,.,,{((,,,(((((((((..(((...........)))...(((((((((((((((((((.{((,....,,},}...........(((((((.((((.....)))).))))))).((((........)))).,.((((((((..{{.((((((((.((((.(({....((((((....))))))(((((({{(.(((.(((((((((((((((.....))}..)))}...))))........)))))))))))))))..||}.((((((((((....)))}...,}))))),||{(({((((((....)))))||{{{((((((((.(((......((((({....(((((.......)))))((((....)))).....}))))).((((((((((((((((((((((((((((((.(((((((((((((((((((((((((((((((((((((({,..,((((((.((((((...,({..((((....))))..}}(((.((.(((((((({((((((...))))))}..)))))))).)).))).(((((((.(...}.)))))))(((((((,......,.)))))))........{(((((((({{{..,..,|||||}}||,...||{{|,,,))}))((((.,(((....))}....,))))...........,.(((((......))))}})}}}}.}}})).,.))))))))))))((((((((((((({{(((({{{{{{((({(((((,,,{,,(,(({,,.{{{,,}||||.....,,)),))))}},||}||||,{{|||,}..,})))),}))))),)...,}}},,))))))))))))).......,(((((((.((((((,{((..(((...)))..))))))))).))))),,))))))))))))))))))))))))))))))))))))))))).)))))))))))))))))))))))))))))).(((({.((((...)))).})))).,.((((((((.((((....))))...)).}))))).}))})))))))}|,,..,},|))||,{.((((((({...})).)))))},,,}})))))),.)))).)))))))).))))){(((((((.{(((((((.{....})))))))}...{((((((((((({(((((.....)))))..)).)))))...)))))}{{,,{{,{|,,{(({{,.{||||{..,||,....,,..}|,,....|))))}))))},,..(((((((((.((((...((((,((((((((((((((....}}}).,....}}.)))))))).))))(((.((.....)).)))..(((({......})))))))))))))))))....)))))))}.))))).))))))))))))))))))).(((((({((,((((.((((........,.)))))))))))))))))....,..((((....))))......,,((({{..,,,...}}}})|{{...,}}}....,,|(((((((({((((.(((((((.((((.....{,{,{{({{(..........}})).)|(((((((((((..((((((..,{{...(((((.{{(((.(((((((....)))....)))).))).,,.)))))..({((((..{,(({{...,,.})})})))))).},}}.{{{(((..{(((((.(((((((({..|{((((((.(((((.{((...}))..)))))...))))...((({.....})))......})}).))))))))).}}})))..)).}}}),,...),,.))))))..)))))...................................{((....))))))))).))))..))))))))))),))(((((.....)))))((((((.((...)).)))))))))).)))}..((((((((........))))))))...)))))))))..})))))))))))...))}}})))))).)))....))).))).}})}.{(((((.,,.....}},)))))).)))))))))))))))..)))....).)))),))))).).})))))..).)))).}}},)))}))},,,,,))))).,)))))})}},...}}}.})))}..((((({{(((((((.(((((...(((((((..(,((((...(((,...}}),,,)))).)||{((((((((((((((,{..,.(((((..........))))).}}))))............{(((((((....))).})))),,{|,,,.)},,.)))))).),.}}}))))))))...))))).))))))).{((({{{{{((((..,,||}}||||||,|}}}}...............|||.((((((((((((((((...,((((((.(((((..((((((((....))))))))..))))).))}.}}|(((((,.((((.((....)).)))).,.)))))}.(((.((.(((..((({...,......,))))..))))).))),|||(((.((((((.((((.(((.((((((((((.((..{....}..))))))...)))))).))))).)).))))).).))).....})})))))))))).)))))).,},,||,|||,.,,,},),)))}}.................,,{{{{{{({,..............}}},,,,}))))))))))))

Transcripts

ID Sequence Length GC content
GUAGGAAUCGCAGCGCCAGCGGUUGCAAGGCCCAAGAAGCCCAUCCUGG… 3427 nt 0.5022
Summary

This gene encodes a protein that is secreted by white adipocytes into the circulation and plays a major role in the regulation of energy homeostasis. Circulating leptin binds to the leptin receptor in the brain, which activates downstream signaling pathways that inhibit feeding and promote energy expenditure. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis, reproduction, bone formation and wound healing. Mutations in this gene and its regulatory regions cause severe obesity and morbid obesity with hypogonadism in human patients. A mutation in this gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Aug 2017]

Forensic Context

A scoping review of human twin studies found that in growth-discordant monochorionic pairs, the smaller twin exhibited increased mRNA and protein levels of the LEP alongside higher promoter DNA methylation [Dany Laure Wadji et al. DOI:10.1371/journal.pone.0315549].