Basic Information

Symbol
LGALS1
RNA class
mRNA
Alias
Galectin 1 GBP Lectin, Galactoside-Binding, Soluble, 1 Beta-Galactoside-Binding Lectin L-14-I Putative MAPK-Activating Protein PM12 14 KDa Laminin-Binding Protein Lactose-Binding Lectin 1 S-Lac Lectin 1 14 KDa Lectin Galectin-1 Galaptin HLBP14 Gal-1 HBL HPL Epididymis Secretory Sperm Binding Protein Beta-Galactoside-Binding Protein 14kDa Lectin Galactoside-Binding Soluble 1 GAL1
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mechanical injury analysis

MANE select

Transcript ID
NM_002305.4
Sequence length
528.0 nt
GC content
0.5833

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-195.10 kcal/mol
Thermodynamic ensemble
Free energy: -204.70 kcal/mol
Frequency: 0.0000
Diversity: 157.90
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.(((((.(((..(((.....(((((((.(((...((((((......))))))..........((((...)))).)))))))))).....))).)))..)))))))))).....(((((.(.(((..((((((((((((...((.....(((((..((((.....(((.(((((((((........(((....))).....(((.(((((...(.((((.(((..((((.((((....))))((....))......))))..))))))).)...)))).).)))..))))))))))))...))))...)))))...)).((((((.....))))))....((((....))))(((((((.(((((((..(((....((((....)))).......(((((......)))))......)))..))))))))))))))((.((((.(.(((((.((...)).)))))))))).)).((((.....)))).........))).)))))))))..))))))).)).
Thermodynamic Ensemble Prediction
..(((((.(((((.(((..(((.,...(((((((.(((.{.((((((......)))))).......,,,{,{,.},)))|.))))))))))...,.))).)))..))))))))))....,{{(((.(,((({{(((((((((({{,..|||...}))|}}||{{|{.....{||||,{{,{{({..,..{{|,{{|,,||||{{{..,{(|{(({{,..(.((((.(((..((((.{(((....)))}((....))......))))..))))))).)...||||||.))},{((((|||||..|,,,|}}},},))))}||{|},,|||||,,,..)}}})}})}}((((....))))((((((,,(((((((..{((..,,,,,,....)))).......(((((......)))))......,,,..))))))))))))))((.((({,{.(((((.({...}).)))))})))).)).((((.....)))).........)))}))))))))),})))}})).)}.

Transcripts

ID Sequence Length GC content
AUCUCUCUCGGGUGGAGUCUUCUGACAGCUGGUGCGCCUGCCCGGGAAC… 528 nt 0.5833
Summary

The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the LGALS1 mRNA is a pregnancy-specific marker detectable via RT-PCR in whole blood and dried bloodstains, with reliable detection from as little as 0.25 cm² of a stain and transcript stability for at least 56 days at ambient temperature [Gauvin et al. DOI:10.1007/S00414-008-0315-6]. A review further notes the LGALS1 is detected throughout pregnancy in dried blood stains, underscoring its forensic relevance [Nanny Wenzlow et al. DOI:10.1177/10406387231153930]. A study in mice demonstrated that the LGALS1 transcript, a marker for heterophilic cell adhesion, was upregulated 4.4-fold in the injured ipsilateral neocortex three days post-closed head injury [Israelsson et al. DOI:10.1089/neu.2008.0676].