| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCUCUCUCGGGUGGAGUCUUCUGACAGCUGGUGCGCCUGCCCGGGAAC… | 528 nt | 0.5833 |
The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the LGALS1 mRNA is a pregnancy-specific marker detectable via RT-PCR in whole blood and dried bloodstains, with reliable detection from as little as 0.25 cm² of a stain and transcript stability for at least 56 days at ambient temperature [Gauvin et al. DOI:10.1007/S00414-008-0315-6]. A review further notes the LGALS1 is detected throughout pregnancy in dried blood stains, underscoring its forensic relevance [Nanny Wenzlow et al. DOI:10.1177/10406387231153930]. A study in mice demonstrated that the LGALS1 transcript, a marker for heterophilic cell adhesion, was upregulated 4.4-fold in the injured ipsilateral neocortex three days post-closed head injury [Israelsson et al. DOI:10.1089/neu.2008.0676].