Basic Information

Symbol
LGALS2
RNA class
mRNA
Alias
Galectin 2 HL14 Lectin, Galactoside-Binding, Soluble, 2 Beta-Galactoside-Binding Lectin L-14-II Lactose-Binding Lectin 2 S-Lac Lectin 2 Galectin-2 Gal-2
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation

MANE select

Transcript ID
NM_006498.3
Sequence length
596.0 nt
GC content
0.5336

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-192.30 kcal/mol
Thermodynamic ensemble
Free energy: -204.60 kcal/mol
Frequency: 0.0000
Diversity: 198.75
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.(.(.((((...)))).).).)))(((.(((((.....((((.((.(((......))))))))).....((((((((((...((((((.(((((....))))).((((((....))))))..(((((((.((....((((((((...((....)).(((((((((((...((((((...)))))).......((((....(((.((((((..((((((.(((((......(((((....((((((((.(((((..((((...(((.............)))...))))..)).).))...))))..))))..)))))))))).)))))).....))))....)))))....)))))))).)))))))..))))))))..(((..(((((.......)))))..))).)).)))))))((((((((.........))))))))..((((.....))))....((((.(((((...((((.(.(((....))).)))))...(((((.....))))).(((..(((.....)))...)))))))).)))))))))).))))))))))................))))).)))..
Thermodynamic Ensemble Prediction
,(((.{.(.((((...)})).).}.})}(((.(((((.,.{.((((.(,,(((,,...,))))))))).,,,.((((((((((...(((({{.{{{{{....}}}}}.{(((((,,,.||||||..,{(((((,((,{{((({((({(..,{{.||||,.|{(((({((({|,{((((({...})))))...,,||||,||}},||..,,{(((,.((((((,(((({...,,,{({,{....{{((((((.(((((..{||{.{,{{({{{{,.,......,}).}})))),,|}.|,|,...})))..)))}..,}}}}})))|,)})))},.,..}}}}||,,||}}|,|..})).,})).}))))))..)))),)))..{{,..,{{{{.......)))))}})},.}}.)))))||((((((((.........))))))))},((((.....))))..}}|{{{,{((((.,.((((.,.(((....))).,)))}.,.(((((.....))))).(((..(((.....)))...)))))))).)))}})))}},)))))))))),,............,.))))).)))..

Transcripts

ID Sequence Length GC content
CUGUUUGUGCUGGGUACUGGGAGAUGCAGGCGGGGAGACACAAGGUAGA… 596 nt 0.5336
Summary

The protein encoded by this gene is a soluble beta-galactoside binding lectin. The encoded protein is found as a homodimer and can bind to lymphotoxin-alpha. A single nucleotide polymorphism in an intron of this gene can alter the transcriptional level of the protein, with a resultant increased risk of myocardial infarction. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human dried bloodstains demonstrated that the LGALS2 mRNA transcript, used for estimating stain age, degrades with its state quantified by ΔCq, and this degradation accelerates with increased temperature and relative humidity [Heneghan et al. DOI:10.1016/j.fsigen.2020.102456]. Further research on human bloodstains stored under indoor and outdoor conditions confirmed that the LGALS2 shows preferential 5' over 3' end degradation, with its ΔCq correlating with time since deposition in specific datasets, and it was incorporated into an elastic net model for age prediction [Hanggi et al. DOI:10.1016/J.Forsciint.2023.111785].