| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUGUUUGUGCUGGGUACUGGGAGAUGCAGGCGGGGAGACACAAGGUAGA… | 596 nt | 0.5336 |
The protein encoded by this gene is a soluble beta-galactoside binding lectin. The encoded protein is found as a homodimer and can bind to lymphotoxin-alpha. A single nucleotide polymorphism in an intron of this gene can alter the transcriptional level of the protein, with a resultant increased risk of myocardial infarction. [provided by RefSeq, Jul 2008]
A study in human dried bloodstains demonstrated that the LGALS2 mRNA transcript, used for estimating stain age, degrades with its state quantified by ΔCq, and this degradation accelerates with increased temperature and relative humidity [Heneghan et al. DOI:10.1016/j.fsigen.2020.102456]. Further research on human bloodstains stored under indoor and outdoor conditions confirmed that the LGALS2 shows preferential 5' over 3' end degradation, with its ΔCq correlating with time since deposition in specific datasets, and it was incorporated into an elastic net model for age prediction [Hanggi et al. DOI:10.1016/J.Forsciint.2023.111785].