| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCCGCAGCACCUCCUCGCCAGCAGCCGUCCGGAGCCAGCCAACGAGCG… | 999 nt | 0.5065 | |
| GCCCGCAGCACCUCCUCGCCAGCAGCCGUCCGGAGCCAGCCAACGAGCG… | 958 nt | 0.5052 |
This gene encodes a member of the galectin family of carbohydrate binding proteins. Members of this protein family have an affinity for beta-galactosides. The encoded protein is characterized by an N-terminal proline-rich tandem repeat domain and a single C-terminal carbohydrate recognition domain. This protein can self-associate through the N-terminal domain allowing it to bind to multivalent saccharide ligands. This protein localizes to the extracellular matrix, the cytoplasm and the nucleus. This protein plays a role in numerous cellular functions including apoptosis, innate immunity, cell adhesion and T-cell regulation. The protein exhibits antimicrobial activity against bacteria and fungi. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2014]
A study in mice demonstrated that the LGALS3 gene was significantly upregulated in myocardial tissues following acute myocardial infarction and was identified as a core monocyte/macrophage-associated hub gene [Yang et al. DOI:10.2147/JIR.S516092]. In human postmortem brain tissue from subjects with opioid use disorder, the LGALS3 protein and its corresponding RNA were both significantly upregulated in the dorsolateral prefrontal cortex, with its protein levels validated by ELISA, and it was implicated in pro-angiogenic networks and increased endothelial cell proliferation [Mendez et al. DOI:10.1038/s41380-021-01259-y]. A review of human studies notes that the LGALS3 reflects myocardial fibrosis and elevated levels are associated with a poorer prognosis in chronic heart failure [Raluca-Maria Cătinas; Sorin Hostiuc DOI:10.3390/ijms26146818].