Basic Information

Symbol
LGALS3BP
RNA class
mRNA
Alias
Galectin 3 Binding Protein M2BP Mac-2-Binding Protein MAC-2-BP TANGO10B BTBD17B CyCAP Gp90 90K Lectin Galactoside-Binding Soluble 3-Binding Protein Basement Membrane Autoantigen P105 Tumor-Associated Antigen 90K Galectin-3-Binding Protein Serum Protein 90K L3 Antigen Mac-2 BP MAC2BP Transport And Golgi Organization 10 Homolog B (Drosophila) Lectin, Galactoside-Binding, Soluble, 3 Binding Protein Transport And Golgi Organization 10 Homolog B
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Mechanical injury analysis

MANE select

Transcript ID
NM_005567.4
Sequence length
2202.0 nt
GC content
0.6117

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-907.40 kcal/mol
Thermodynamic ensemble
Free energy: -949.64 kcal/mol
Frequency: 0.0000
Diversity: 575.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((.((((((((((....))))...((....))(((((((..((.(((((((..(((((.....((.(((((((((.......)))(((.((((......)))).))))))))).))...)))))(((((((...(((((....((((.....))))..))))).((.((((.....((((((((..((.((((((.(((((((((((((.....(((((((((.(...((((((((((.(((((((.(((((((((..((......(((((((((...((((..(((((.(((.((.(((..((...((((((((((....(((.(((((..(((((((((((((((....)))(((((((.((((........(((((.(((((((((....(((...))).((((.....))))((((...))))((((.(...(((....)))...).))))...............(((((((..(((.((..........)).))).)))))))))))))))))))))((.(((......)))))..)))).))))))).....((((((((((..(..(((((((((..(((((...(((((((((((((....((((((((((((((((.....(((((...)))))))))...)))))))))))).((((.((.(((((...(((((.......(((.((((...((.(.((((.((((....)))).)))).).))..))))))).((((.......))))(((((((..((...))..)))))))....((((....)))).((((((.......))))))((((.((.((((.....))))))..))))..)))))...))))).)).))))...))))))(((((......))))))))))))...))))).))))..))))).)..))))))))))...)))))))))..)))..)))))..)))...))))))))))....)).))).)))))))))).)))))).)))))))...((((((....((....))...))))))))...))))))))).....)))))))))...(((((..(((((.((((((((((((((((((...((((((.....))))))((.((((.(.((((.((((.....)))).)))).).)))))).((((.(((((((((((((..........(((((..(((((((.(((....))).......((((.......))))((((((.(((....)))...((((((...((((...))))...))))))..))))))..((((...)))).........((((((((((((.......(((((...((((.(((...((..(((.((((((.(((((((...(((.((....((((((.((((((((.(((.((((((..((((.....((.((....)).))...)))))))))))))))))...))))........))))))....((((...(((..((((((.....((((.....)))).....))))))..)))...))))...)).))).)))..)))))))))))))..))...)))..))))........(((((.......))))))))))......)))))))).))))..(((((((((...((((.(((((....((((((..(((...))).))))))..(((((((....)))).)))))))).)))).....)).))))))).)))))))...)))))....))))))))))))).))))...)))))))(((((....)))))......)))).))))...)))..))))).))))).((((((........)))))))))))..)))).)))))))))...))))))).....((((((.....((((.(((......(.(((....))).)..))).))))...))))))......)))))).....))))))))..))))))))....)))))))))).)))..((((.((......)).))))))))))))))))))))..))))))))))))))..(((((((((((...((((.((((.((((((((..(((.....))).(((.((((.....)))).))).))))))..)).))))))))..))))))..))))).........................
Thermodynamic Ensemble Prediction
....((((((({{((((((({{....(((((.((((((((((({.......{{..(((((((((((((.((((((.(((((((((((((.((((.((((((((((((.({.,|,(({..,|||..}...((((((((((((,,((({.,((({((,({((((({.{(..((((.(((..{..(((((....))).)).,..)))..))))..},||,.}},||||||}}||(((((,...,))))).,.((((((((((((.(({{{{{{..,..,.,(((((.(((((((..((((,(,({.,(((((({((.((((((...((....))...)))))),})}.)))))),,,)),,...)))).)).))))).)))),...(((((((...))))))),}}|||...)}}}})))))))))))),,||,,.,)})||||}|.}}||{....,)),,})})))}}}},{(((.{.{.,.(((((((..(((.((..,,....,,)).))).)))))))..},.,))))))))))))).))))))))....)),)))))))}},}...))..))))))))))))),(((.((({{...,}.,)).))}(((((....))))){((((((((({(({....,(((({...})))))))}.},,))))))))))))).)))))).((((((..((((...{(((.,,..({(.(.(((.((((.({(((((,,,.,((,{((((((((,,..||||.((((.......))))(((((((..({...})..)))))))..((((({{|.....((((((((.......))))))))(((({,(((({...,||||{((((((.({{{{((.{(((({(({,,{{||...|||,(((((((..(((...(((.(((((.((....((.....((((((((....))))).)))....))...)).))))).))).))))))))))....|((((({{.,..,,},))))))))|(((((((((((.,........((((...{{(,.(((({{{(((.....)))))))))},.}}).)))).((((........))))).)))))}}))).))}||||||||....}}}}}}..))))))))))}}}}}}}}((((.((((.....)))).)))){{.(((((....)))))||.,,{||||}},|}....}}})},,}}||,|(((,{(({{{,(({((((,..{(((.,....,))))))))))||||,..,}||,...{{{{.,||{|||..{{||,,|,|}||||{{((({{...,,,,..{||||..........,,,,,||,,.....}}}}|,,,....||}).))}}))))}.|,|.}))},.)))})}.))}}|||}|.}},.{(((((,({{{((({{(((.((((((..((((.....{{.((....)).}}...)))))))))))))))))..,)))}....,...))))}|,.,.||,|,,,,}|,.|}}},,}))).})).}}},.,}))}}.(((((((((((((((.(((((,{,{{,{|{{||,.{(({(,((,({(((,|...((((({.(((.((.(((((({,({{,,.,{,|}||(((||,...||}.}.}})).))))),{((((.((..{((((.(((((.....((((((..(((...))).)))))).)))))))))}..))...))))))))))))).)))}))))).,.)),|}))})).))))}......,,||||||,)))).....,,.....|||(((|,.,}})))},......,((|,.}|||.|{(((,(((((......,((((((........)))))))})))...)})))})}))))...}))}))}}}).})))).))...))))))))))))).)))).)))))))))))))}}))))).,))})))))))..)))...........(((.{(.....)).))).........{((((.....))}}},.}.......(((({...})))}.}}}))))),)))))))))))))))..(((((((((((...((((.((((.((((((((..{{{.....}}|.(({.((((.....)))).))).))))))..)).))))))))..)))))}.,))))).........................

Transcripts

ID Sequence Length GC content
AUACUGGGAGAGGCUUCUGGGUCAAAGGACCAGUCUGCAGAGGGAUCCU… 2202 nt 0.6117
Summary

The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. LGALS3BP has been found elevated in the serum of patients with cancer and in those infected by the human immunodeficiency virus (HIV). It appears to be implicated in immune response associated with natural killer (NK) and lymphokine-activated killer (LAK) cell cytotoxicity. Using fluorescence in situ hybridization the full length 90K cDNA has been localized to chromosome 17q25. The native protein binds specifically to a human macrophage-associated lectin known as Mac-2 and also binds galectin 1. [provided by RefSeq, Jul 2008]

Forensic Context

A review of multi-omics studies in humans identified the LGALS3BP as a proteomic aging biomarker with higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192]. In a separate study in mice, spatial transcriptomic analysis following traumatic brain injury demonstrated that the LGALS3BP gene was upregulated in the neocortex, corpus callosum-external capsule, and striatum at 7 days post-injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528].