| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUACUGGGAGAGGCUUCUGGGUCAAAGGACCAGUCUGCAGAGGGAUCCU… | 2202 nt | 0.6117 |
The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. LGALS3BP has been found elevated in the serum of patients with cancer and in those infected by the human immunodeficiency virus (HIV). It appears to be implicated in immune response associated with natural killer (NK) and lymphokine-activated killer (LAK) cell cytotoxicity. Using fluorescence in situ hybridization the full length 90K cDNA has been localized to chromosome 17q25. The native protein binds specifically to a human macrophage-associated lectin known as Mac-2 and also binds galectin 1. [provided by RefSeq, Jul 2008]
A review of multi-omics studies in humans identified the LGALS3BP as a proteomic aging biomarker with higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192]. In a separate study in mice, spatial transcriptomic analysis following traumatic brain injury demonstrated that the LGALS3BP gene was upregulated in the neocortex, corpus callosum-external capsule, and striatum at 7 days post-injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528].