| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGAGGACUCAUCCAUCUGCACAGCUGGGGCCCCUGGGAGGAGACGCC… | 1936 nt | 0.5212 |
This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. The receptor can also function in antigen capture and presentation. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the LILRB4 transcript, a marker for immune response, was upregulated 15.8-fold in the injured ipsilateral neocortex three days after a closed head weight-drop injury, indicating its involvement in the inflammatory molecular changes following mild traumatic brain injury [Israelsson et al. DOI:10.1089/neu.2008.0676]. In human sepsis research, the LILR family, including related receptors, was found to be upregulated in monocytes, and a separate study using machine learning on single-cell data identified a specific LILR family member as a robust diagnostic marker with high AUC values in external datasets and validated its potential as a therapeutic target for atenolol in a mouse sepsis model [Ning et al. DOI:10.07/s10753-023-01803-8].