Basic Information

Symbol
LILRB4
RNA class
mRNA
Alias
Leukocyte Immunoglobulin Like Receptor B4 LIR-5 ILT3 LIR5 CD85k Leukocyte Immunoglobulin-Like Receptor, Subfamily B (With TM And ITIM Domains), Member 4 Leukocyte Immunoglobulin-Like Receptor Subfamily B Member 4 Leukocyte Immunoglobulin-Like Receptor 5 CD85 Antigen-Like Family Member K Monocyte Inhibitory Receptor HM18 Immunoglobulin-Like Transcript 3 Leucocyte Ig-Like Receptor B4 ILT-3 HM18 B4 CD85k Antigen
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Cause of death analysis

MANE select

Transcript ID
NM_001278426.4
Sequence length
2095.0 nt
GC content
0.5241

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-699.60 kcal/mol
Thermodynamic ensemble
Free energy: -734.05 kcal/mol
Frequency: 0.0000
Diversity: 603.76
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((..(((((((((((((...((((((.....(((((((((.(((.(((.........))).))))))(((((((((...((((....((((((...)).)))))).))))))))))).))))))....)))..(((((((((((....(((.((((((....((((((((..(((((..(((....)))..)))))..)))((((((....((((....((((((............((((((.....((((..........)))))))).))............)))))).))))...)).))))(.((((((((((..((((((.......(((((.......))))).(((((((((.((((((((((((.(....))))).))))....))))...))))))))).................))))))..))))))).))).)(((((((....((((((.....(((((((.(((...(((((((..(((........(((((.....))))).(((...))).((((((..((((.(((((.(((.((.((((((.(((((........))))).))))......)).)).))).)))))))))..)))))).)))..)).))))).))).)))))))......))).....)))(((((......)))))..((((.((((..........(((.((((((((((((...))))))).....))))))))........)))).)))).))))))).)))))...((((((((....(((((((((.((.(((((.(((....)))))))))).)).)))))))(((((((((..(((((((((...((((((.(((((((((((((((..(((.((((....((((((((((..........(((.(((((((........))))))).))).((.(((((...(((((.(((..((.........)).))).)))))...))))).)).((((...)))))))))).))))))))....((((.(.((((..(((.....))).))))).))))...(((((........)))))(((...)))........(((...((((((((((((..........((((............))))(((((((.......))))))).......))))))))))))..)))(((..(.....)..)))..)))..)))))))........((((((((((.((((((((.....((.(((((((.(((((.((.....((.(((.(((.(..((............))..)))).))).))....)))))))..))..))))).))..))))..))))))))))))))((((...)))).............))))))))...))).......))).))))))))))))))))))...))))))))..(((((((((.(((((.((((.(((..((((((...(((.((...((................))..)).)))...))))))..)))..)))))))))...((((.....)))).((((.((((....)))).))))(((....((((........))))....)))..........(((...((((..((((.......))))..))))..)))........((..(((......)))..))(((((.((((.((((((.....................................((((.(((((((........)))))))..)))).......(((((....))).)).....................)).)))).)))))))))................)))))))))..)))))).))).....)))))...))))))...........((((((((......))))))))...)))....)))))))).....)))))................((((((((...((((((...(((...(((.....))).)))...........................(((((......)))))..)))))).....))))))))....))))))...
Thermodynamic Ensemble Prediction
.((((((..(((((((((((((..,((((((,,,,,(((((((((.(((.(((.........))).))))))(((((((((,{.(,({.{{{(((,,,}}})),),)},.}},))))))))).))))))....}}|..,,{(((({,{{..||||{{(((((({{{((({(((((..{((((,.{{{.,,,}}|,,|||||,.}}|{((,((((.(((.{{.,,{(((({{{..,||{{{..,(({{{....)||||.....,,{......|||{.{{(,........)))}}}.,,,)}}.}},.}}}}}.}||((((((((..((((((.......(((((.......))))).(((((((((.((((((((((((.{....})))).)))),,,.)}))...))))))))).................))))))..)))))))),{({((,,({{{...}}|.||{|,,,.||||{{{.{||},,||||||,..|||......,{((((({,...,||||{{{({{{||}.{(((({..((((.(((((.(((.((.((((((.(((((........))))).))))......)).)).))).))))))))).|})))}},||...||.|||||{|||.}}|||||,,,...,.||.,||||||||,}|{{{(((,(({{{({((,((((...,|.,,}.(((.((((((((((((...))))))).....))))))))........}}||,}|||{.,(((((..,,,,.}}}||,||||.}}}((((((({({((.(((({,(((....)))))))))).)).)))))))|||||||||}.|||((({{(.{{(((({(,({((((((((((({({{((({(({{....((((({(({({.........(((.(((((((........))))))).))).,{{(((({..,||||{.|||.,||,}......,))}}))}))}},..,)))))})}.((((...}}}))))}}|,|||||||}....(((({(((((((((,{.....||,.((.((((....)))).))....}}..,.}.))))))....}}))....}}}}..((((((((((((..........((((............))))(((((((.......))))))).......))))))))))))..,}}|||,,|....,)),,}),.))),})},))))}}}}.,,}||||{,,,{|}|||||,||...}}||,|||||||.||{{(,{.....,|,.,||}|}}.,.))}}|....}}}}}.})}||||..}}},)))},}|||,}}}..)),.))))),}}.}))))}}}}},,,}}}|||||(((..{{|||,..{{{.....{{{{|((((|.......))))...,,),,)))),,,,,,))),,))})},))))))),.|||||||{{.{{{{{.{{||,||,,|||{|||,..{||,|{,,,|||,,,,,}.......,..|.,||,}}}...}))})),}))}..||||}}|||,..((((.....)))).{|||,,,||,....,,..||,|{|{.,,,(({({{{{,...))))},..|||,{..............||||,.{{((,,,....}|||..||||..((((,...,)))).}}}}..,||.,,,.|}||{,,,{((((.((((({...,.,...............................((((.(((((((........)))))))..)))).......{((((....}},.}},....................}}.}))).))))))|||.....}},........))))))}))..}}}}}},}}}...,.)}))}|,,}))))}},.........((((((((......))))))))...}}}....)))))))).}}}.))}},................((((((((...((((((...(((..{({(......|{,,,{{|,,,..,,.....,.,.....}}}.,,}|}}.}}}}.)))....)))))).....))))))))....))))))...

Transcripts

ID Sequence Length GC content
ACUGAGGACUCAUCCAUCUGCACAGCUGGGGCCCCUGGGAGGAGACGCC… 1936 nt 0.5212
Showing 11 to 11 of 11 entries
Summary

This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. The receptor can also function in antigen capture and presentation. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the LILRB4 transcript, a marker for immune response, was upregulated 15.8-fold in the injured ipsilateral neocortex three days after a closed head weight-drop injury, indicating its involvement in the inflammatory molecular changes following mild traumatic brain injury [Israelsson et al. DOI:10.1089/neu.2008.0676]. In human sepsis research, the LILR family, including related receptors, was found to be upregulated in monocytes, and a separate study using machine learning on single-cell data identified a specific LILR family member as a robust diagnostic marker with high AUC values in external datasets and validated its potential as a therapeutic target for atenolol in a mouse sepsis model [Ning et al. DOI:10.07/s10753-023-01803-8].