Basic Information

Symbol
APLNR
RNA class
mRNA
Alias
Apelin Receptor APJ AGTRL1 APJR G-Protein Coupled Receptor HG11 Angiotensin II Receptor-Like 1 Angiotensin Receptor-Like 1 APJ (Apelin) Receptor FLJ90771 G Protein-Coupled Receptor APJ G-Protein Coupled Receptor APJ HG11 Orphan Receptor APJ Receptor HG11
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_005161.6
Sequence length
3660.0 nt
GC content
0.5527

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1422.60 kcal/mol
Thermodynamic ensemble
Free energy: -1489.06 kcal/mol
Frequency: 0.0000
Diversity: 1098.02
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((....)))))((.(((...(((.((((((((((.(((((..((((((((((((((((((....((((.(((((((.(((((((.....((((((((.....)))).)))))))))))..))))))))))).........((((((((..((..(((......((((...(((((.((((((...((((((.((((((((((......(((........)))(.((((((((((((.....(((((((((((((.(((((................((((.(((...((((((((.(((....))).)))))))).......((((((......)))))).....((((((((((((((.(((((((((.((..(((((.((((((((....))))))))))))).)).))..)))))))..)))))(((.((((((.....)))..)))))).(((.((((((((..((((.(((((((((..((.(((...((((((...)))))).))).))..)))))))..(((((...))).))..........)).))))))))))))))).......))))))))).((((((((((.(((((((((.((((..(((.......)))....))))...)))))).))).))...))))).)))(((((..(.(((((((((((((((((((((..((.((..((((((((..((((..((((((((((...((((...((((((...)))))).)))).((((.(((..((((.....))))((((((((((((((....))))).)))).)))))....))).)))).)))).))))))..))))...(((((..((((((....))))))...((((((.....))))))......))))).............))))))))..)).)))))))))(((((((.((..(.......)..)))))))))((((((..((((((((((((((((((.((((.(((.(((..((...((.....)).))..)))))).))))))))))............))))))))))))))))))...)))))))).....)))))))..)))))......))).))))...(((....))).(((((........)))))..)).))))))))))))))))..........((..((....))..))...(((......))).(((((((((.....(.((((((....)))))))))))))))).)))))))))))).).)))))))......(((((((.((.((((((.(.(((((......))))..(((((((..................)))))))((((((((((.(((...))).))))))..))))(((((((..((.(((.((((.((.((....((((......))))...))))..(((.(((((...))))).)))..)))).)))))..))))).))...........).).)))))).)).)))))))..((.(((.(((..(((((....((((.....))))....)))))..)))))).))...)))))))))....)))).)).)))))..))))......)))..)).))))))))((((((((((.......))))))))))....(((((........))))).)))))))).(((((((.((((((................))))))..)).))))).......................))))).)))))..))))).))))).)))))))).))).))(((((...((((((((....))).(((((((((...(((((((((.(((((..((.((((((((.......((((((((.(((((.......)))))..((((.((((...(((((...(((((((((((.(......)))))..)))))))..)))))...)))).))))..)))))))).))))).)))))..))))))))))))))..((((((((.....((.(.(((((.(((.((....(((((....((((((((((((......(((.....))).(((((...(((((..(((((..(.((((.....)))).)..)))))..)).))))))))....((((...((((((.((((....((((((((.((((.....((((((...((((((...)))))).))))))....))))))).....)))))..((((((((.((.((...)).)).)))))))))))).)))))).)))).((((((((((((((((((((.((((...((((.(((.((.....((((((.....)))))).....)).)))))))...)))).....((.(((((..(((.......(((((((((((((..((((....((((((.....((((((.((((((......)))))))))))))))).))....))))...))))))((.(((((((((((..(((((((.........((((((....(((((.((.((((((........)))))).)).)))))))))))..((((((((((((((((...(((..(((....)))(((....))).......)))...)))).))))))))).))))))))))..)))))).))..................((((((.((.((....))....))))))))....))).))(((........)))(((((.......)))))..((((...))))..))))))).....)))....))))).))((((.(((..(((((((.((..((.((((((.(((.(((((((((.(((...))).))))).)))).))).)))))).)).(((......)))........)))))))))..))))))).(((......)))))))..)))))..)))))))))))...(((.((((((.((((.((((....))))))))..)))...))).)))(((....)))..))))))))))))....)))))....)).))).))))).).)).....))))))))...)))))).)))....)))))..)))))...(((((((((((..(((((........((((.((.(((....(((((.(.....((((((.((...((.((((((((((.((((...((((.((((((((((((((((((.................))))))))))).........((((.......((((...))))(((((......)))))......)))))))))))))))))))))))))(((((..(((.(((((.((((((...(((((......)))))..............(((((...)))))((((((((.((((((((((((......(((((((....(((((((((....))))))...((((((.(((.((((........)))))))))))))...((((((..((.((((.......))))..)).)))))).))).....)))))))..)))))))))).)).)).))))))...)))))).))))))))..)))))..)))).))...)).))))))....).)))))....))).)).)))).))))).......))))))))))).
Thermodynamic Ensemble Prediction
(((((....)))))((((((((({,....,,,.,{(((((((..(((({....}.)))).))))))){(((.(((((((.(((((((.....((((((({.....}))),,))))))))))..))))))))))),}}})))))),.((((...((((.({...}).)))))))).((.(((((.((((((..{{.(((((((((((((((.((({,.,((((((({{({{{{({(((,(({{{.,..}))|))},|||{{{|,....,,,.,}}}}...,))))))}...((((((((.(((....})).)))))))).......{(((((......|)))}|,{,.....,,|.,(((((,((((((((((.(({(((((.{((((((((....)))))))))}|}||}{{||.,||||||||||{{((({(,((({((.....}}}..)}}}))|{(({((((((((..((((.({{{(((((..((.(((...((((((...)))))).}}}.})..)}}}))}..(((((...))).)).......,..}}.}))))))))))).,......||}},.,}),}})}}}})|))}}}}|}},..,(((((((((({.{(,..((((,,(((((.......))))))))))...,}.,,))))))))))).}||{|||.{||||,||||||,.|||||{,....})})))}))}))))))})))))).,,{{{{...((((((...)))))).}))),}}}}}}}},.{{((.,...)}}|((((((((((((((....)))))},)))}}))))}..)))}..,)))))))})))))).)))))..|(((({..((((((....)))))).....((((((.(((({{((((.((((..((.,,...((((((((((.({..,,.,,,{{.(((.(((((((,,((..(.......)..)))))))))).))){{.((((((((((((((((((.((((.(((.(((,.((...((.....}}.)).,)))))).))))))))))...........,)))))))))))).||{{((..((((((...(((((((..((.((((((((..,.(({{...,,,.(((....))}.(((((........)))))((((..,({((({((((((((((((((((((((((((((.{((((((..((((.,((({({(((((((((((.....{.((((((....)))))))))))))))).})|{,(({{{(({{{{,,.,,........((((({.{(({.(((({,..||||}.....||||,,((({(({{..({(.,{{,.({{{..,||,,||,...((((((.(((...))).)))))).,,(((((,(((,(((({(({{(((,.((,((....((((,.,,,,||||,,.||||..|||,|||,,..,||||{,|{{({({{........}},....})}},........,,}...}}})}}}|||}}}}||||}|||,,((({{,..,,......,,.....}))))...|||||..,|||||,{(((((((((({....{{{..{{{..,,({...,)}...,,..}}}.....)))).))))))}}.{,..{{...{{{..(((((((((.(,,..,({{,.{{,.,.|,.|,(((..(((...(((.(((((....}},,)).)))))).))}}),,}.}}})}}}.,,.,,.}.))))))})).})}...)}.,},....,})))}),}}||}||||||||{||}.,|}|||{{{,|||((((....)))},...,,,,,.,,,,(((((((,,,(((,.(({((({,{{({,{{..,(({({{,,.(((((.......))))),..||..||||..,||||{...{((((({((((.{......})))}..))))))}..,}}}}...,,,,,}))).})))})))).}})))}}))))..)))))}))||||,}}}}}}}|,|,,....,,}|}}}}}})}},.,|.,{{{||.||}}),)}}))}})})}......(((.....}}).(((((,..{((((..(((((..(.((({.....}))).)..)))))..)).))))))))}})}}},|....,,,,}}}}}....,,{{.,(((.((((.....((((((...((((((...)))))).))))))..,.)))))))..},}))))))}}..})}}))}........).)))))))).)))))))))))))..))))).))).)).,.))))((((((((.{,...}}.)))))))).,,|((({,({,{{.}}||||{,{{|{{{{||{,(((((((({.....,.{((.((,|((....))))).)))|,{{{{{{..((((.,,.((((({....,(((({((((((((.....,}})))))))))))))).)),}..)))).,})))))).{{{{.{(((((((..(((((((.........{(((({...,(((((.((.((((({.,{....|}))))).)).))))))))))}..((((((((((((((((...{{{,.{{{...,}}}|||....,,,.......}))}}})))).))))))))).))))))))))..)))))).))....,)})).........{{({{{,,{,{{....)),,,,))))||||{.,.{{{,,,,,,,.|||.,.))}||(({,,....,}}}}}.}}|}}}|}},})}}}))}}.{|{|(((((((..((((.((.((((((({.,(((((((.,{..((.((((((.(((.(((((((((.(((...))).))))),,))).))).)))))).)).(((......)))........||}|}},}}..)))}}||,{{{......}))},...))})))}..((((..(((((..(((.((({((,(({({((({....})))))))..}}),,.))).)))(((....)))..((((((((..........,))}))))))))))..)))).,)))))).)).))))..)))))))...))))})))))))}))})).{{(((,.{((((......)))))})))}}}}})))),..)))))))).))..)))).)))))))))..}))}|}},.,,}|{(,((({{....})))),}(((((((((((.,....,......,,}.))))))))))).}).))))))))))...,,..))..)))).))))))))).)).))))..))}}}}))).))...)))))))))))))}|((((..(((.(((((.((((((..,(((({......})}}}.,...,,,,.....{((({...})))}((((((((.((((((((((((......(((((({,,..,{,((((((....)))))).,.((((((.((,,((((........))))))))))))).,.{{(({{..||.((((,{,.,,||}}}..)),)}))})})))....,)))))))..)))))))))).)).)).))))))...)))))).))))))))..)))),...((((((.,.{......),.))))))..)))))).))))).))...{{.((((((....))))))})...

Transcripts

ID Sequence Length GC content
GUCUUAACUGAGACGGGGGUAAGGCAAGAGAGGGUGGAGGAAAUUCUGC… 3660 nt 0.5527
Summary

This gene encodes a member of the G protein-coupled receptor gene family. The encoded protein is related to the angiotensin receptor, but is actually an apelin receptor that inhibits adenylate cyclase activity and plays a counter-regulatory role against the pressure action of angiotensin II by exerting hypertensive effect. It functions in the cardiovascular and central nervous systems, in glucose metabolism, in embryonic and tumor angiogenesis and as a human immunodeficiency virus (HIV-1) coreceptor. Two transcript variants resulting from alternative splicing have been identified. [provided by RefSeq, Jul 2009]

Forensic Context

A single-cell transcriptomic analysis in a rat model of radiation-induced lung injury identified the APLNR as an orthologous rat gene associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357]. A study in mice demonstrated that the APLNR mRNA expression was up-regulated in an acute cavernous ischemia model and down-regulated in chronic vasculogenic erectile dysfunction models of hypercholesterolemia and diabetes [Kwon et al. DOI:10.1111/jsm.12158].