Basic Information

Symbol
LOXL2
RNA class
mRNA
Alias
Lysyl Oxidase Like 2 WS9-14 LOR Lysyl Oxidase-Related Protein WS9-14 Lysyl Oxidase-Related Protein 2 Lysyl Oxidase-Like Protein 2 Lysyl Oxidase Homolog 2 Lysyl Oxidase-Like 2 Delta E13 Lysyl Oxidase-Like 2 Protein Lysyl Oxidase Related 2 Lysyl Oxidase-Like 2 EC 1.4.3.13 EC 1.4.3 LOR2
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mechanical injury analysis

MANE select

Transcript ID
NM_002318.3
Sequence length
3721.0 nt
GC content
0.5748

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1436.60 kcal/mol
Thermodynamic ensemble
Free energy: -1499.35 kcal/mol
Frequency: 0.0000
Diversity: 1057.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(.(((((((((((..(((.......)))..))))).(((((((((.......)))))...)))).(((((.(((.....)))..)))))...((((.((((((((((((((((((...((((((.(.((..(((....)))..))).)))))).))))...............))).)))))))))..))))))(((((((((((((((((((((((((.((((((...........(((.......))))))))).)))).))))))......((((((((((((((((((((((((((((((((.(((((...((((.(((((...((.(((...(((((((((........(((..((((((..(((((.....((((.((((..((((.(((((.(((....((..((.....((..((((.((.....))))))..))))..))...))).)))))))).)..))))))))..((((((..(((((.((..(((((.((((..........)))))))))))))))))))))).)))))..)))))).))))))).))))).))).))...)))))))))(((((.......)))))....((((.(((.........((((((((.(((...((..(((((....)))))..))..((.((((((.(.(((((((.(((...(.((((((.(((((.((.....)).))))).).)))))))))....((((...(((((((..(((((.................)))))...)))))))...))))((((((((((..((((....))))...))))))..))))...((....)).))))))).))))))))))))))))))))..))).)))).(((.(((....))).)))(((.....))).(((.(((((((.....(((((.....)))))....))))))))))..))))).)))).........(((.(((((......(((((.((((...))))))))))))))..)))(((((((((((.....(((((..(((..((((.((((.(((..(((((..(((((((((((((((((((.(((...)))))).......)))))).).....))))..))))).)))))))).)))).))))((((.........))))...(((.(((((.....(((((..((.((((..(((((.(((.((...)))))..))....))).))))))...))))))))))))).)))..)))))......))))))))))).....((((...))))......))).)).))))).)))))).)))).)))))))))))))))....(((((((((.....(((...((((((.....(.((((((...(((((((((((((((((((.....((((((((.(((....))).)).))(((((.....((((((((.......)))..)))))..)))))..((((((((((((((((..(((((........))))).(((((.(((((..((((......)))))))))...)))))(((...((.((((.((.(((.......))).)).)))).))....)))(((((....((((((((((..((((((((......(((((((.((.((.(.((((((((((((.(.(((((.((.((((((((..(((.....((((..(((((...)))))..((((((((..((((((..(((((.......((((((.(((((.(((((..(((.((((.((....)))))).)))(((((.(((((.(...(((((((......))).))))..))))))))))).((..((((((.((((.....)))).).....)))))..))(((((((((.....((((.((((.......)))).)).))..)))))))))..(((.(((((((((..(((((((..(((((((((.........(((....)))((((((.(((.((((.....))).....).)))...)))))))))))))))(((((((((.....(((((.(((((.....))).......)))))))......)))))))))(((....)))....))))).))..))))))))).))))))))))))))))))))))))...(((..((.(((....))).)))))((((....))))..(((((....))))).((((...)))).....))))))...............))))))))....)))).....)))))).))).)).)))))))).)).).))))))))).).)).))...((((((.......))))))..)))))))(((((((((((((((....((((((..............(((.((((....)))))))...........(((((..((..(((.(..((((......))))..).)))))..))))))))))).....)))))))))..)))))).(((((.(.(((......(((.((.(((....((((((((((.........(((((....))))).))).)))))))))).))))))))).))))).))))))))..))))))))))))))).....((((......((((((((..((((((((((((((((((........((((((......((((...(((((..((((.......)))).))).))....))))((((((((.....))))))))................))))))))))..)))...)))(((((((((((((....))))((((.((((..(((((((((.(((.(((((....)))))..))).....(((((((((....)))))))))..............((((((((((((((..((.(((((..........))))).))((((((((.((.....(((((....))))).....((((((...(((..(((......))).)))))))))(((((((.(((((.....))))).))...)))))..................(((((((((.........))))))..)))))))))))))..))))...))))))))))...)))))))))......)))))))))))))))))((((.((((((((..((................))..)))))))).))))......))))))))....)))))).)))))).(((((((........)))))))...........((((.....))))...)))))))))............(((((((((..((((.((..((((((......((.((((((.....)))))).)).....)))))).)).)))).(((((((((.....((((..(....(((.......)))....)..))))....)))))))))........))))))))).((((.(((((((((((..(((...))).))))))).)))).(((((...))))))))).....))))))).)))).))))))..)))))))...)))))))))))))))))))..))).....)))).)))))...............))))))))((((((.....))))))...........)))).)).)....(((((....((((((((((..........)).)))))))).....)))))........
Thermodynamic Ensemble Prediction
(.(((((((((((..(((.......)))..))))}((((((((((,,.....(({|....((((.((((({((,....}))...|||||.,.((((.((((((((((({((((((...((((((.{.{(,,(({....}})}}}}}.)))))).))))}....,}.....,},})),))))))))),.)})))){{||||||(((((((((((((((((,(({{{{|||........|||.......))))})))),)))).))))))......((((((((((((((((((((((((((((,{{{(((((((..,,,.,,(((.((((..,,..}}|||||(((({.....((((({{(((({(..{(((({{{{{((((.((((.{((((,(((((.,((,,.,(({{(,.....{{.}||||}{,,}}}.)))),,..,|||..||{{{||,,}|||||||{|..||||||||{{(((((({{((((.((.{{((((({,,,,..({{{{..{|,||||||,,|||||,|||,||.,,,}}}}}}))))},.)))))})),,)}))){||{..,,))))|||(({(,..,}...))))),||{((((.{{,.{{{{{{{{.,,,,,,,}}}.}}})}..,||||.,.}))))|||||,,({.((((({.{.{{|||||.|||..||.||||{,,|||||,|(.....||.}|}|}.},})))}|}}}....((((...,((((((..{{(((.....,,.,,),.,...))}))...))))))|...}}})(((((((({{..{(((....)))|,,.||||}||.}|||.,,((..,.}|.}}|||}}.})))})))),..))))))))),})))}))).{{{.||{,..|}}},|||({(.,,.{|||{({,,{{|||,{...,.{||||,,|||}})||,,,|}}}}((((((((({{(,(.((((((...,(((....}})),....)))))}.}))).))).)))))).)).))}})))||||{,,,|||}}..,|||||..|||...((({((..,(((((({(((,.|(((((,,{(((({{{.{,||||..,)}}...,}..)).))}))).)}},.})))),.)))))},),}},,},))))}})))((((.{{....}.)))),..((((..{....,..))))....,{{{,...(((((.,....,.)))))))}.))}.,.))))))),,)}}.)))))).}))))),}))}})))))}}...,)))),,,,,)))))}}{(((...)))),}..).))).}).))))).)))))).)))).))))))))})))))),,,,(((((((((...,.(({.,,({((((...,.{.((((({...(((((((((((((((((((.....((((,{({.(((...,||}.||{|,{((((.....{(((((({..,,,,.})},.||}}},,}|))},,(((((((((({(({((,.(((((........))))).{{(((.{((((..((((......)))))))),...))))){{||..,{,{{,,,{(|({,..{{{{.((,((({{{(({{,{...{{((((((....((((((((((..((((((((......(((((((.((.((.,.(((((((((({(.{.(((((.((.((((((({..(((.....((((..(((((...)))))..{(((((((..({((((..(((((.......((((((,{((((.(((((..(((.(((,,({....}))))).)))(((((.(((((.(...(((,(((......))).))),..))))))))))).{{..(((((,{((((.....)))).,...},)))))..,}(((((((((.....((((.((((.......)))).)).))..)))))))))..(((.(((((((((..(((((((..(((((((((..,,,....|||....}}}((((((,(((.{(({.....))).....).))).,.)))))))))))))))(((((((((.....((((,.{,,,{.....,||{{......,)))))}}}...)))))))))|{,....,}}....))))).))..))))))))).))))))))))))))))))))))))..((((..{(.(((....))).)}}}}|(((....))))..{|{||}},,})}}}.((({...})))..,..}}))))}..............)))))))}....)))).....)))))).))).)).)))))))}.}}.).))))))))).}.)).))...((((((.......)))))).,)))))))(((((((((((((((....((((({....,,,,.,....{{{.||||,...}}}}}}}...........(((((..((..(((.(..((((......))))..).)))))..)))))}))))).....)))))))))..)))))).(((((.(.(({.....,({((((.(((....((((((((((.........(((((....))))).))),}))))))))).))))))))).))))).))))))))..))))))))))))))),,..,,,,,....,,{,{{{{,...||,,{}|,}||{,||||{||||||{|||||({{.,,,{((((,..({(((..((((.......)))).))).))..,|||,|(({(((((.....)))))))).,....||,,.,||,||((((((....)))))),,.||||||{||||{{{....}}},((((.((((|.(((((((((,,,,.{|{|||...|})|},|}}}.,...(((((((((....))))))))).,..,}..,.....((((((((((((((,,((({(((((...,,}}}.)}.||{||((((((((.(,...,.(((((....))))).....((((((,..{((..(({......})).))))))))}((((({,.(((((.....})))).}}...)))))..,.......}}......{{,{(((((.........})))))..})))})))))))),.})))...)))))))))).,.))))))))).,....)))))))))))))))))}|{{.{(((((((..{{................}}..)))))))|,}|||.....}}))),,}}.,,,,))))),,,}||}.(((((((........)))))))...........((((.....))))...)))}}}))}|,,|,.,|,...(((((((((..((((.((..((((((......((.((((((.....)))))).)).....)))))).)).)))).(((((((((.....((((..{....(((.......)))....,..))))....)))))))))........))))))))).|{{{,(((((((((((..(((...))).))))))).)))).(((((...))))),))}....,)))))}}.))}).))))))..)))))))...))))))))))))))))))},,))).}.,,)))}}})))}......,..,,,...,))))).))))||.,,.,})))))))))))......)))).)).}....(((({....((((((((((..,....,..))}})))))))..,,.}))))........

Transcripts

ID Sequence Length GC content
GCGACUCCAGCGCGCGGCUACCUACGCUUGGUGCUUGCUUUCUCCAGCC… 3721 nt 0.5748
Summary

This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]

Forensic Context

A review of RNA-based forensic body fluid/tissue identification in human samples notes that the LOXL2 is mentioned as a specific mRNA marker for skin (SK) [Liu et al. DOI:10.1007/s00414-025-03656-2]. In a separate study using a mouse model of mild traumatic brain injury, the Loxl2 transcript, which encodes the LOXL2, was found to be upregulated 3.5-fold in the injured ipsilateral neocortex three days post-injury, indicating its involvement in oxidation-reduction processes following neural trauma [Israelsson et al. DOI:10.1089/neu.2008.0676]. A study in humans demonstrated that the LOXL2 mRNA was detected in skin swabs, saliva, urine, and vaginal fluid samples, but its overlapping expression levels across these body fluids rendered it unsuitable as a specific marker for identifying skin or sweat as the source of touch DNA [Akutsu et al. DOI:10.1016/j.legalmed.2018.05.003]. A review further noted that the LOXL2 is significantly overexpressed in skin tissue and is detectable in forensic samples such as thumbprints [Nanny Wenzlow et al. DOI:10.1177/10406387231153930].