| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGCAAAAGAGCAGAGCUACCAUGUCCUCUUGGAGCAGACAGCGACC… | 2605 nt | 0.5658 |
The leucine-rich repeat (LRR) family of proteins, including LRG1, have been shown to be involved in protein-protein interaction, signal transduction, and cell adhesion and development. LRG1 is expressed during granulocyte differentiation (O'Donnell et al., 2002 [PubMed 12223515]).[supplied by OMIM, Mar 2008]
A study in mice demonstrated that the LRG1 was upregulated in hearts after cecal ligation and puncture (CLP) operation, with its expression pattern noted as part of the gene expression signatures of sepsis-induced myocardial injury [Yan et al. DOI:10.3389/fphys.2022.903164]. In human patients, research identified the LRG1 as a differentially expressed mRNA with potential diagnostic value, showing it was downregulated in myocardial fibrosis versus acute myocardial infarction and upregulated in heart failure versus myocardial fibrosis, and receiver operating characteristic analysis indicated an area under the curve >0.6, supporting its diagnostic capability for both conditions [Wang et al. DOI:10.3389/fcvm.2021.664044]. A study in human blood plasma from 103 individuals demonstrated that the LRG1 (Leucine-rich alpha-2-glycoprotein) was significantly upregulated with age and was utilized as part of a 21-protein panel to build age-predictive models [Salignon et al. DOI:10.18632/aging.204787].