Basic Information

Symbol
LRP2
RNA class
mRNA
Alias
LDL Receptor Related Protein 2 Gp330 Megalin DBS Low-Density Lipoprotein Receptor-Related Protein 2 Glycoprotein 330 LRP-2 Low Density Lipoprotein Receptor-Related Protein 2 Heymann Nephritis Antigen Homolog Calcium Sensor Protein EC 3.4.21.9 EC 1.1.2.3
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_004525.3
Sequence length
15657.0 nt
GC content
0.4590

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-4873.40 kcal/mol
Thermodynamic ensemble
Free energy: -5159.58 kcal/mol
Frequency: 2.2025e-202
Diversity: 3343.39
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((((((.((.(((((((((.((..............)).)))))))))...((((((...((((.(((((((...))))))))))).....(((.(((..(((((((((((.((.(((((.....))))).)).)))(((((.(((((((.......))))))).)))))))))))))))).)))))))))..)))))))))))))..(((.((((((.(((((((.....))))))).)))))))))(((..((.(((...))).))..)))...........(((((((.(((((((((....(((((((((((((((....((((((((((((.......((((((((.(((.((((..((((((((((.....((.(((.....))).))((((......)))).(((((((((.((((((((((((((((.((((.(((...((((((.((.(((((((((((((((((((((((((.....((((((((((((...(((..((((((((((.((((.((((((.((..((...((((.....((((((............)).))))))))...))..)).))))))...........(((((((......)))))))..((((((((.(((((....)))...)).))))))))((((.(.(((((((((((...((((....))))...)))......)))))))).)..))))....)))).))))((((....(.((((((.....)))))).)....))))..((((...........))))))))))))).))))))))).((((((....((((....))))...))))))........))).....))))))).......(((((((((.((.(((((((......(((((..(((((((((((...(((((.(((((((...(((...)))(((.(.((((((.(..((..(((..((((((...))))))..)))...(((((.((((.(.(((((..(((((.......((((.(((((..((((((((......(((((((((((((((((((..((((.....((.(((((((((.(((((........).)))).))......((((((((...((((((((.(.((((.((((......)))))))).).)))))))).))).....))))).(((((.(((((..((((.(((((((((((((((((....((((.((((.((....((((.....))))...))))))))))....((...(((((........)))))...))((((((..(((.(((((..((((.(((...(((..((.((((...)))).))...))).))).))))....)))))....)))...)))))))))))..)))).)))))))))))).(((.(((.(((((.(((((((.((.......)).))))..))).))))).))).)))......)))))))))).......((((((((...(((((....)))))....)))))))).(((((...((((((.............((((((((((..((....))...)))).)))))).(((((..((.(((((...))))).)))))))...((((((((....(((((...(((....((.....))..))))))))...))))))))....((((((((...)))))))).(((((((((.....((((.((((..(((..(((((((((((((((.((((........))))...........((((((((.....(((((.((.((((((((.......(((((.((..((((((((((.((((((((((.(......).)))))).......(((......)))((((((.(((....((((...(((((..(((................)))..)))))...)))).....))).))))))......(((((.......(((........)))......))))).))))..))))))).....)))....)).))))).((((((....((((............))))..))))))((((((((.........(((........))).......))))))))..((..((((((((((..((((.((((.((........)).))))))))...((((.((((.........)))).)))).))))))))))..))((....)).....)))))))).)).))))).....)))))))).)))))))))))))))..))).)))).))))....)))))))))..((((.(((..(((((((((.(((..........))).)))))))))))).)))))))))).)))))...((((((((((.((((((((......)))))..))).))).)))))))..))))))).))..((((...))))))))....)))))))))...((((((.((((((.((..((...((((((....)))))).))..)).)))))).)))..)))....((((((((((....)))..))))))).........)))))).)))))))))))).....(((...)))))))).)))))))))))))).).)))))))))........))..).)))))).)))).....(((((.((.(((.(((((((......))).))))))))))))))........)))))))((((((((.((.((.(((((((((..((((((.((((...((((.(.((((((....)))))).)))))...))))..)))).)).))))))))).)).)).........))))))))...))))).)))).)))).)))..)))))(((((.(((((((.(((..(((((((((.((((((.(((..(((...)))...))).)))))).....((.....)))))))))))..))).)))))))))))).(((.........)))..(((.(((....))).))))))))))..))(((......))).(((((.....((((((((....(((.((..((((......)))).))))).(((((.........((((((..((((.((((((((...)))))...))).))))..))))))...(((.(((((((.......(((((.((((.(........).)))).)))))....))))))))))....)))))))))))))....))))))))))))))..))))))..))).))))).)))).)).....))))))))).)))))))...................))))).)))))))).))).))))))))))).))))))))).))).))))))))(((.....)))......(((((((..((((((..........))))))....)))))))(((((((((((..(((.(((.(((((((((....((((((((((((............)))))((((((...))))))..))))))).((.(((..((((.((((...........)))).))))..))).)).....(((((((((((((((.((((((((((((.((((((((.(((.((((((.........))))))))).).))))))).))).)))))..))))..))).))))))))).)))((((........))))..(((((((.(......).)))))))(((((((....)))))))))))).....))))..))).)))..)))..))))))))..((.((((((((...)))))).)).))((((((((......)).((((((......))))))(((((((((((.....(((((((((((((((((..((((...((.....)).))))....(((((.....)))))..........)))))...))))))))))))((((....))))..........((((((((...)))))))).)))))).......))))).....))))))..(((.(((.....))).)))(((......)))))))).)))))))))))))))))...)))))...)))))))))..))))))).((((((((((..((((........)))).....(((((......)))))..........((((.((((((((.((........)))))))))).))))..((((((((((((((((.....((((.....)))).....((((((.(........).))))))..........(((((....)))))..(((((...)))))..)))))))).)))..)))))((((((((.(((..(((((((((((((((.((((((((.((((((((((((.((((.(((.(((((((((((((.((((.((((((.((...))..)))))).))))...)))))))..........(((((....)))))....))))))....))).....((((((.........)))))))))).))).)))))))(((((.......)))))....(((.(((((.........))))).)))((((......))))..((.(((((((...))))))).))...((((((((..(((.((((((..(((.......)))..)))))))))....(((((..(((((..(((((..((((((((((..(((..((((.((.......)).)))).......(((..(((..(((....((((....))))....))).......(((...(((((((((.((((((.((.......)).).))))).))..)))))))...))))))..)))..(((((.....)))))...(((((........))))))))..)))..)))))))...))))).....((((....)))).......)))))..)))))...)))))))).((((((((..(((.((..((((((((........))))))))..)))))..)))).))))((.(((....))).))....)))))))))))))))((..(((.(....(((......)))....).)))..)).......((((((((.((.((.((....)).)).)).))))))))))))))))))..)))))))))))..........(((((((((...))).))))))..((((((((.((.(..((.(((....(((((..(((.(((((((...(((((((...(((((((((..((((((...((((((((...........))))))))....(((((((((((((((.....))))(((((((((.((....)).)).)).))))).((((.(.........).))))...............(((...)))....))))))))).))))))))....((((((((...))))))))((((((((((.(((((((((.(((.(.........((((((((..........(((((((..........((((...)))).((((((((.((((((...((....))....))))))))))...(((((.(((.(((..(((...)))))).))).))))).(((((...((((.......))))...)))))....)))).(((((........)))))..((((((......((((((((((............(((((((..(((((((((((...))))))...))))))))))))..((((.(((((.((...(((((((.((.(((((.((((.........))))))))).))))))))))).))))).)))).....((((((((...)))))))).....((((......))))........((((((((.(((((((....)))))((.((((.((((.((((((((...((((((((........))))))))....)).....((((.((...((((((........((((....)))).(((((((....)))))))((((((((((((.(((((.(((((.((.....((((..(((((((((((((((((((.((((((((((((((....(((((((........(((.(((..............))).)))(((((((..(((((((.(((..(((..((((((.(((((((...((((.(((.((......))..)))..))))((((......))))(((...))))))))))(.(((((((((((((..((((((((((.......))))((((...))))(((((..((((((....(((((((..(((.(((.(((((..(((((((((...((((....))))...)))).)))))(((.((((...((.(((((((.(((((((((((((((.....(((((((((....)))))).)))))))).)))))).......((.((......)).)))).)).))))))))).......(((((((.(........)..)))))))...)))))))..))))).))))))..)))..))))...))))))..))))).....))))))..))))).)))))))).)..........((((((.(((((((.(((....((((((((((..(.((((..............))))...)..)))))........(((((((.((((((((((....((((.(.((((((((...((((.......)))).(((.(((.(((.......))).))..).)))(((((((((((((...(((.((((......((((((((((((((((((((((((..((....))..))))))))((((.((..((((....))))..)).)))).....)))))).)))))))..)))..)))).))))))).)))))))))(((((((((....(((((((((((.(((((((((((((...((((((..(.(((((((((...((((((.....))))))..(((.(((....))).)))((((.((.(((((((...((((((....(((((.(((((((((((((........)))).)))((((.(((((((....)))))))(((......))).)))).......(((((((.(((........))).)))).))).........)))))))))))..)))))))))))))..)).))))..(((((..(((...)).)..)))))....((.(((((((...(.(((((((.......))))))).).(((((...((((((((((.(((((.(((((((((((..(((..(((......(((.(..((.....))..).))).(((((((...........))))))).(((((((((((....))).))))))))....((((.((......)))))).........)))))).)))))))))))(((((((......(((((.....((((((((((((...........(((((((..(((...(((((.((....(((...)))(((..((((....))))..))).(((((((((((......(((.(((...((.....))..))).)))....((......)).)))))))))))...)))))))...)))..)))))))))))...))))))))...))))).......((((((((..(((.((....)).))).......((((((((((.((((.(((....))).....)))).))))....(((((((((.(..((((((((((....((((.........)))).......)))))))))).(((.(..((((((((((..(((....)))..))))).)))))..).)))..(((((((..(((((.(((........)))..))))).))))).)).....((((((....)))))).(((((((((.((............................)))))))))))))))))))))...............)))))).))))))))))))))).((((((((((............))))))))))....((((((....((((((....(((((.((((.(((((((.((.(((((.((((((((((.(((((((((((((((((......)))).)))))))))))))).....(((......))))))).)))))..))))).))))))))))))).))))).((((((((((...((((........))))...))))))....))))..........))))))))))))))))).)))))...)))))...)))))(((.........))).....((((....((.(((((....))))).))..)))).......((((.((((((.(((((((((.....))))))))).)))))).))))))))))).))..))))))))).)..))))))....))))).....((((((((((..((((....))))..))...)))).)))).))).)).))).))))))))))).....))))))))).(((((((((.(((.((((((((..(((((((..(((((((......((((((...((((((..(((.......)))..))))))))))))((.....((.(((((.......))))).)).....))..(((((((((..(((......))).....)))))))))......((((......)))))))).))).....))))))).))))))))(((..((..((((((.(((((.............(((((((((.(((((.((((((......((...))......)))).)).))))).))))))))))))))..)))))).))..)))((((((((...(((((..((((((...(((((.((..((((((((((((.((((............))))(((((...)))))..((((((((((.((.((((((((..((((.((.((......)))).)))).)))))))).)).(((((...((((...((.(((....)).).))))))...)))))..((((.(((.((...........)).))).))))((((((((..(((.(((((.....))))).))).)))))))).((((.....))))((((((..((.(((((.(((((((.(((((..(((((..........(((((((...(((((....))))).)))).)))............)))))..))))).)...((.(((((.((..(((((.(((((((....((.((..((.(((((....((((...((((.......)))).))))..))))).))..))))))).))))(((.........))).(((.((((........(((((.....))))).(((..(((.((.(((((((((....))))))))).)).))).))).)))).))))))).)..)).))))).))..................)))))).))))))))))))).(((.((.(((((.....))))).)).)))............)))))))))))))))))))))).....((((.(((.(((..((...))..))).))).))))...((.((((.((((((...(((...........))).)).))))..))))..)).)).)).)))..)))))).))))).......))))))))..........(((((....)))))))).)))))).)))((((((((((.((((((((((((.(((((.(((.........((.((.(((((((.......((((((.....)))))).((.(((((((((((.(((((...))))).))).(((...((((((((...............((.((((.(((..((((...))))))))))).))((((.(((((..((.....))..))))).))))(((.....))))))))))).))).(((.....)))((.((((((.((((((((...))))).))))))).))))..............(((((.......)))))))))))))))..((((.......))))..))))))).))))((((..(((((((((((((.(((((((((((((.(((((((((....(((...(((((((.......((.((((((((((((((((....))).....(((((.......)))))....((((...(((((....)))))...)))).........))))))))))))).))(((.((((((((((...)))).)))))))))......(((((...((((((((.(((((((((....(.((.(((((((..(...(((.....))))..)))))))..)))....))))...)))))....))))).).))....)))))........)))))))...))).))))))))).))).(((((.((((.(((((((((((...((.((.(((((.(((..(((((((((((.(((((((((((..((((..........))))....(((((((..(.((((((((((.(.....((((((((((((.(((..((((((((.((....((((((((((((..((((....((((.....(((((((..........)))))))......)))))))).))))).....(((.....))).(((((....))))).((((((((((...(((.((((.(.((((((....(((.(((((....(((((((.......)))))))((((((((((.......(((((..........))))).))).)))).))).....(((.((((((..(.((((......((((((.(.((....)).).)))))).((.(((....)))))........(((((.(((((((..........)).))))).)))))..)))).).)))))).)))...))))).)))))))))))))).))).)))))))))).)))))))....))..)))))....))).)))...)))).).).)))))).......).))))...)))))).))))))))...........(((.((((.(((.(((((((((((.....)))))))..((..(((((........(((((.(((((((((...))))....))))).)))))........))))).)).......)))).))).))))))).((.(((.(((..((.((.(.((((..(((((((((((....(((((.(((((..............))))))))))..)))........))))))))..)))).).)))).....))).))).))((((((((((.((((.....))))(((......)))....))))))))))((.((....(((((((.((.(((((.....))))))).))...)))))...)).))....)))))))))))..))))).(((((....)))))............)))))))))))))).))..))....)))))))....)))).)))).)))))((((..(((((......)))))....))))))))))))))))))....(((((.(((..(((((((...........(((((((..(((((((.((((((...)))))).))).))))..))).))))....(((.(((.((((....)))).))).)))....((((((((((..((((.((..(((((((((..((.((.(((.(((.(((((...............))))).)))))).).).))..)))))))))...)).)))))))).))))))(((((.((................)).))))).....)))))))))).)))))((.((((((((((..(((((....))))).))).))))))).))....)))))))))))))..........(((.(((((((((((..........((((((.......)))))).((((.......(((((..........(((((.(......).)))))...((((((.(.(((...(((((((((..(((((......))))).))))))...................((((....))))((((...(((((.((((((.((....)).)).)))).)))))))))..(((.((((........))))..))).)))....)))..).)))))).)))))))))))))))))))).))))))))))).)))))..............((((((((....)))))))).....))).))))))))))))))..((((..(((....)))..)))).))))))))...).))))...))))((((((........)))))).....(((((((((...(.(((((((...))))))).)))))...)))))....((.(((((((((((.....((.....((((.......)))).....)).........(((..((....))....))))))).))))))).)))))))).))))))))))))...))).))))))).)))))).))))))...(((((((...((((((((..((((((((.((((((......))))..)).))))))))....))))....((((..(((((((....)))))))......)))).......))))...))))))).)))))))))))))...))))))).(((..((((.(....).))))..))))))))))...))))))...)))))))).)))...)))))))).......((((.....((((((((((..(...........((((...))))..(((.(((.((((.(..(((((((.......)))))))..))))))))))))..).))))))))).))))))))))))..))))....)))))))))))).))))))............(((((((..((..((((((......(((.(.(((((.((...)).)))))).))).....))))))(((......)))........))..)))))))...))))))...)))))))).))))..((((((.((((...((((((((((.(((((.((((.......))))..))))).))).((.((..(((.(((.....))).)))..)).)).................(((((.((((((((......))).((((((.....(((....(((((((((((((((..(.....)..)).)))...((((((((..(((......(((.((.(((.(..........).))).))..)))......)))..))))))))......(((.(((.....))).)))......(((((...(((((..((.((.((((((.......)))))))).))......))))).)))))((..(((((....)))))..)))))))))))))))))))))...)))))...)))))..))))))).))))))))))((((......))))..)))))).)))).)))).)).(((((.(((((.((((((((((..((((..((((((.........(((.....(((((.......)))))......)))..........))))))))))..)))....))))))))))))))))).)).)))))))).))))))))))...)))))).........((((((.....))))))....(((((.((....)))))))...))))))).....((((((((((..((....((((((((....(((..(((((((...((((........((((........))))....((((.(((......)))))))....((((..((((...((((((...))))))...........)))).))))...(((.......)))....)))).))))))).)))...((((((...((.(((......((((((((...((((...(((......((.(((((((((.(...((.(((.((...(((((((..((((.......(((((......)))))...............(((((((..((((((.((.....((((........))))......)).)))))).)))))))))))))))))))).))).))..).))))))))).))...))).))))......((((((((((......((((((((.((((.(((((((((((.((.......)).))))))).))))))))..)))))))).))))))))))....(((.......)))...................)))).))))))).))...)))))).(((((((......)))))))..........(((((((....((((.(((....((((((((.......))))))........(((((((..........))))))))).....)))))))(((((.(((((((((.....(((((.(((((((((..((((........))))((((...))))...((((...((((..(((((.(((.(((((....(((((..(((((....((((((.(((..........((((((((((...(..((((......))))..)))))))))))))).)))..)))...)))))....)))))..)))))))).)))))...)))).))))(((((.(((........))).)))))(((.((....)))))...))))))))).)))))...(((..((((((((..........))))))))...))).))))))))).)))))))))))).....(((((........))))))))))))))).)))))))))).))))))))..).))).)))).)))))..))))))))))...............((((((((((((.((((((.((((((((.........(((((((.(((((((.......(((..........................)))......))))))).)))))))...........((((......)))).(((.((((......((((((((......)))))))).....))))))).......)))))...))))))))).)))))))))))).......)))))))))((((((((......).)))))))((.((.((((((..((((.((.(((.(((.((((((((((((........)))))))))...))).).))..))))).)))))))))).)).))..........)))))))...))...)))))...)))..)))))..((((........))))....((((.(((((((..........)))))))...)))).((((((((........))))))))..))).))..).)).))))))))........))))))))))..((((((....((((((((.(((((((((((.......))))))))))).)))...(.((((((...)))))).).......)))))))))))))).((((.(((((.(..........).))))).)))).
Thermodynamic Ensemble Prediction
.((((((((((((((.{(.(((((((,{{({{{,,.,,....{|{||{|||,},,,,.},||||||.}}((((.(((((((...)))))))))))..{,.,{{.,||..(((((((((((,((.(((((.....))))).)).)))(((((.(((((((.......))))))).))))),)))))))})),))).,)))))})))))))))))))..((((((((((((((.,,.(((((.{..,{{(,({(((((((((...,....}}.)))}))}}),,.}}|.,,.((((((((.,{,(((((.,,....,..))))),.(((((((((((((..(((..(((((.(((..{(((((((..((((.......))))..)))},))),{((.((((((..((((......))))..))).))).))...,(((((((((((({.,.((((((.,((((..(,((((((((.,(((...{,.,,)}.,,}|||.,....,,.},...,((((((((((((((({{{{||.(({{(((((({(((..((((.((((((((((.........((.(((((((((..(((((,.(({{((({(((((.,((((.(((((((......)))))))...)))}.,.))))){((((,,,(((((..((((((((((((.((((....(((({(,{(((....))))}}}}))}.((,{{.....)))}{({{((..((((.((((.(((.((((.(,((((((((...((((((((.{.{((.((((((...{((((((((((((((.{.((((....((((......))))(((((((((((((((...(((((.....(((..((((((....{.{{{,{{,..,{(((.((.(.((.((((((....)),}))))).).)).)))||((((((((.(((((((,,((((........(((((.(((((((((((((((,,{{(({,...|}|}}}}||||...((((,,((((.(,(((((..(((((,......((((.(((((..((((((((......(((((((((((((((((((..((((.....((.((((((({(.(((((.,......}.)))).}}...,,,((((((((...((((((((.{.((((.((((......)))))))).).)))))))).))).....))))).,{{({.{{{{{,,((((.(((((((((((((((({,,,.((((.((((.{{.{{{((({.....}))).,.}}))))))))....((...(((((.,....,.))))),..|}((((((.,{({.(((((..((((,(((.,,{((..{(.((((...}))).}},..}}},))).))}),...)))))....}},...)))))},)))),.}))).)))))))))))).{((.(((.(((((.({(((((.((.,.....)).)))),.,}).))))).))).})}......||||||,,,|,,||,..((((((((...(((((....)))))....)))))))),((({(,..((((((..........{{,((((((((((..{(....))...)))).)))))}.|||,,..||,{({((..,))))}{||||,||,..,,{{{{{|.,,,{{||(||,{||..,.))}..}|}},{||||||||.,.,,))}},.....,{{((((|,..))))}}}}.(((((((((.....((((.((((..(((.,(((((((((((((((.((((........))))...........((((((((.....(((((.,{.((((((((.,.....(((((.((,.((((((((((.{(((((((((.(......).)))))}.......{((.{{,,,|},,((({(,{((,.,.{{{{,,.|{{{|.}||,|||||,,,,.,...,})}||.}|||}.,,}}}}||,||,||,||||||......{||||,....,||||...,,...}))......}}}}},})))..))))))}...}}),},..,}}.))))).((((({....{{{(||||.....,,.})))..))))))((((((({.,....,..,,{.,|||...,,..,,.,}})))))))),.((..((((((((((..{(((,(({,.{{......,.)),))))))},.,,((((.{(((,,......,)))).)))).))))))))))..))||....}},,,,,)))))))).},.))))).....)))))))).))))))))))))))),,))).)))).))))....)))))))))..,|||.}|}},}||||||||}|||}}}..,.,,,,..|||})|}},},}},)))))))))).})))).,.(((((({,{,.{{{{{(((......))))},}}},.,}}.})))))),.))))))).))..((((...))))))))....)))))))))...,({(((.((((((.{{,,{{{,.((((((....))))))..},,)).)))))).)))..}},....((((((((((....)))..))))))).........)))))).)))))))))))).....{((...)))))))).)))))))))))))).),))))))))).||.,,,..|||{{({,,{|{{{{|||...,{{{{.,{,{||.|{||{||,,,,..}})},}},}}}}|||,,,...,....((((...((((((((.{,.((.(((((((((..((((((,({({..,(({{.,,(((({{..,,)))}},.}))},...)))),.}))).)).))))))))).}}.},.........))))))))..)))).)))))...)))}})))).)))))))))))))))).))))))))},,}}}}||,{{{{{(.,..((((((.......(((((.(((({{{((((.((((((....((((((((((((.{(,(({((,{{{{,{,{{,.({(,,,{{{{.{((,,..)}},}}}}.}},|||,{,(((,,....}}}.||,,...,,{((((((({....(((.((..((((......)))).))))).{(({,........|{{{{||,,||||,(((((({{...}))))}..})}.}})}..}}}))).,.||{}|((((((.......{((((.((({.{,,......)})))).))))}....}))))))}},....}||}|}}}}}}))}|,.,{{|(,,,,...},))))).,}}))))))))))))....(((({((((((((..(((,,,.....,......}))..))))))))..,{((((((((..((,{(({..,{,.(((({....))))).))))))).))))...))))..,,)))))((((..((((((..........)))))))))))))).)).)))))))))).))))))))))){(((((..((((...})))..)))))},,,......,}}}((((((...))))))...,.,,||.((.(((..((((.((((..,.....,..)))).))))..))).)).,,,|||||{(((((((,((.((((((((((((.((((((((.(((.((((((.........)))))}))).).))))))).))).)))))..))))..)}},))))))))).))},))))))...)))......)))))...))))))))))))))){((((({....)))))))))))....,.))))))).).....)))))))..))))))))).,.((((((...)))))).{{{{{((,((((({.....,|,((((((......)))))}|{((((((((,.....|||||||||{{{(((((..,,,,.}}||,....}}}))))}}}.|||||.....}||||{{{{.{|.,,|||||...}}}}}}|||||,{{((....}))),,........((((((((...)))))))).}}))),}},.,.}),,))}}}}})}||}|.((((.(((.....))).))))...,,.)))))))),...)))))))).,,,.)))).))).))))))))..)))))))))).))))))))...))))..)))))..}.((({((....))).)))..))))))))}..})),.}))))...))))))))).)).....)))))))))).))))..))},,,{,,,..(((({....))))}....}},,...,}||||||},........}.}}|||}(((((..((((.((((,...{((((((..((((,,.{((({(,{...((((((({((((((,....,,..((({(,..}}}}})}}}})),||||,..,}.))))))).})))))}.|,..(((((((((((((.((((.((((((.{,...,}..)))))).))))...))))))}..........,,|||..{{|,,,)},.,)))))).,,,)))).))))))))))).)))).)))))}))},,..}},,),,)).|||{{.,,,,,,,}},,..)))))))))))).,,,))))))))}..,{((((......))))}.((.(((((({...})))))).))....)))),))))))....}.))))..)))))))).....}..))).))))).}}}))))))))))))}.....)))))))).||{{(({,((((.{(.......)).)))}.....,.{{{,.({(.,({{..,,{{{(,.,,||}}....}}},.....,(({.,.((|(((({{,(((({.(((,,,,...}|.}.}))}}.)))}))))))),,}))))))..))}..(((((.....)))))..}}}}}}}.).))))))))))))))))))}.((((((.{((((((((((.((((....))))...,,.{{{.......}},.||.,{{,|||.(({{((((..(((.((..((((((((........))))))))..)))))..)))).)))).}}||{,.,,}}}||},...,},,,,},.((((......))))............))))).))).))}.))))))...((((((((((.((.{(,((....})})).)).)))))))))).,|,..}}{{(((((.((({(((....,,,{({{{||(((...))).)))))}..{(((((((.((.(..((.(((....(((((..(((.(((((((...(((((((...(((((((((..(((({,...((((((((...........))))))))....(((((((((((((((.....))))(((((((((.({....}).)).)).))))).{{{{.{.........}.})))...............((,...,,),...))))))))).))}))))}....((((((((...)))))))){(((((((((.(((((((((.,,,.(,{{,...,.((((((((..........{((((((,..,,{{{{.((((...}))).,{,.((((.((((((...((....))....))))))))))...{((((.(((.(((.,,{{...}|.))).))).))))}||||||},,{({,..,,...||||,..,,,,.,}},,,...(((((........)))))..((((((......((((((((((............{((((((..(((((((((((...)))))).,.))))}))))))}..((((.(((((.((...((((((({((.((((,{((((.,....,..))))))))).))))))))))).))))).)))).....((((((((...)))))))).....((((......))))........((((((((.{((((((....))))){(.((((.((((.((((((.,{{{((((((((........))))))))...,.(({{{..(((.((...((((((....))),|||,..}}))),.}|||||..}}.,||||,.{(((({((((((.((({{{(((((.((((((((,,...|||||}}}((((((((,((.((((((((((((((....(((((((......,{((({((({...,,,,|,,,...,,..|,(((((((..(((((((.(((..(((..((((((.(((((((..,{{((,({,{{{......,,..})}|,|,||||{{...,,.}))}{||...)))))))))){.(((((((((((((..((((((,(,,.......,,,,((({...}))){((((..((((((....(((((((..((,{(((.(((((..{((((((((,..((((....)))).,.)))).))))|((,{((((...((.(((((((.((({(((((((((((,...{(((((((({....)))))).)})))))).)))))).......|{.{{,.....,,,)})).)).))))))))).......(((((((.{........}..)))))))...))))))),.))))).))))))..))}.,))))...))))))..))))}...,.))))))..))))).)))))))).,..........((((((.(((((((.(({.,{{((((((((((..(.((((..............)))).,.)..)))))........(((((((.((((((((((.,,.((((.(.((((((((...((((.......)))).(((.{((.(((.......))).))..}.)))(((((((((((((...(((.((((......(((((((((((((((,((((((((..((....))..))))))))((((.((..((((....))))..)).)))).....,))))).)))))))..)))..)))).))))))).)))))))))(((((((((.{,.(((((((((((.(((((((((((((...((((((..(.(((((((((..,((((((.....}))})),}|||,{{{.....}},}},((((.((.(((((((...((((((....(((({,(((((({{(((((........))))}|}}{(({.(((((((....)))))))(((......))).}}}}..,}|..(((((((.(((........))).))))}})).........)))))))))))..)))))))))))))..)).))))..(((((..{(,...,}.)..)))))....((.(((((((...(.(((((((.......))))))).}.(((((...((((((((((.(((((.(((((((((((..(((..(((......(((.,..((.....))..}.))}.(((((({..{,.....}}))))))).(((((((((((....))).)))))))){,,,((((.,,.....,)))})).........)))))).)))))))))))(((((((,,,,..(((((,....((((((((.{{({..........(((((((..(((.,.(((((.((.,..(((...))){{{..((((....))))..)},.{((((((((((.....,(((.(((...({.....))..))).))).,..{(......)),))))))))))}.,.)))))))...)))..))))))),)})}..))))))))...))))}.......((((((((..(((.((....)).))).......(((((({,{{.((((((,...}}))),..|{||||.}||,....||((((((((((.((((,,,)})}}}))|,,})}}}..,.{{{{,....,)))),}}))))}(((.(..((((((((((..(((....)))..))))).)))))..).)))(({..((((((({((({(((.,....,,||}.,(((((((({{{{{{..,{{((((((....)))))).}},.{((((....,},,.........,,,,........,,,)).)))))))))))}),}))}})))))}}......)))))),))))))))))))))).((((((((((............))))))))))....{{((((,...{((({{....(((((.((({,(((((((.((.(((((.((((((((({.(((((((((((((((((......)))),,)))))))))))),.....(((......))))))).)))))..))))).))))))))))))).))))).,.,,|||,|||...))|||{{.{{.(((....)))}},.,}}}},,...,,}}..,)))))))))))}))))).))))),..)))))...))))){{{|...,,,..{({{{,..,{{||.......}})),,...|||||}..})))},......((((.((((((.(((((((((.....))))))))).)))))).))))))))))).))..})))))))).)..))))))....))))),....((((((((((..((((....))))..))...)))).)))).})).))}))).))))))))))).,...))))))))).(((((((((.(((.((((((((..(((((((..(((((((......((((((...((((((..(((.......))}..)))))))))))){{,..,.((.(((((.......))))).)).....,}..(((((((((..(((......))).....)))))))))......((((......))))))))}})).....))))))).))))))))(((..((..((((((.(((((.......,.....((((((({(.(((((.((((((...{{.((...))}}.,..))))},).))))).)}))))))))))))..)))))).))..)))(((((((({,.(((((..((((((.{.(((((.{(..((((((((((((.((((............))))(((((...)))))..((((((((((.((.((((((({,.((((.((.((......)))).)))).)))))))).)).(((((...((((.{.,,.,((....)).}.}.})))...)))))..((((.({,.,,.,,,,......,}.))).}}}}{(((((((..(((.(((((.....))))).))).)))))))}.((((.....))))((((((..((.(((((.((((((.((((({..(((({(,,((,{(((.,((({{,,.(({{({{..|||||{||||,,|,.,,.....|,,||||},,}})))))....}}})))))}.,.,)).)))))))))),((((({((((((.(((((....((((...((((.......)))).))))..))))).},,}))).,,)))))){{(.,.......}}}|(({.((({.,.,,,,.{{|||,,,..}}||||,{(,,(((.((.{((((((((....))))))))}.)).))).,)).)))).))}},,...{{(((...{{....}}....))))}......)))))).))))))))))))).{((.((.(((((.....))))).)).))}............))))))))))))))))))))))...,,((((.(((.(((..({...})..))).))).))))...{(.((((.((((((.,,(((,.......,..))}.)).))))..))))..)).},.,}.))}..)))))).))))).,,..,.}))))))).,,,,,{,..,,,,,.,,.}))}}))).)))))).)))(((((((((((((({((((((((.(((({.((((.,{,..{(((.((.(((((((.......((((((.....)))))).{(.((((((((((({((,{,.,{{||||.....}}}..,|||,(((({{{,.....,{{{.(((.((({{(((,.((({...})))))))))).))||||,|((((..{(.....)),,}}}}}.}})}(((.....))),,,,))))})))..,|}}}}})|{((.((((({{((((((((...))))).))))))).))))}.,.....{{{{{{.,,{,.......)))))))))))))}}..((((.......))))..))))))).)))))|||,.(((((((((((((.(((((((((((((.(((((((((....,{{...(((((((.......((.((((((((((((((((....))).....(((((.......))))).,,,((((...(((((....)))))...)))}....,}},.))))))))))))).))(((.((((((((((...)))).)))))))))......(((((...(({(((((.(((((((((....{.{{.(((((((..(...(((.....))))..)))))))..,}}....))))...)))))....))))).}.))....)))))........)))))))...})}.))))))))).))}{(((((.((((.(((((((((((...((.((.(((({,(((..(((((((((((.(((((((((((..(((((((....(((({,|....(((((((..(.((((((((((,({....((((((((((((,(((,.((((((((.((....(((((((,,,{({,{{{{,|||((((.....(((((((..........)))))))......}})}}}},.,}}}}.,}|,||{.....))),{((((....})))}.((((((((((...(((.((((.(.((((((....(((.(((((....(((((((.......)))))))((((((((((.......(((((..........))))).))).)))).)))..,..(((.((((((..{.((((.....,((((((.(.((....)).}.)))))).|,{(((....))))}........(((((.(((((((..........)).))))).)))))..)))).).)))))).)))...))))).)))))))))))))).))).)))))))))).)))))))....))..))))}....))).))),,,)))).).).)))))).....}}).))))...)))))).)))))))).,,.......(((((..((((.({(,,.(((((((.....)))))))..,{..(((((........(((((.(((((((({...})))....))))).)))))....,,..))))).}}..,{{{{,.,,.,,...)))))).)}))))..)))))}.)))))((((..(((((((({((....(((({{(((((...,......}...))))))))))..}}}.....,,.))))))))..)))))))))))....,{{{{.(((((((((((((((.((((.....)))){{{.,....,}}.,,.)))))))))),,,.(((((.,,...},))))),|,.....,}}))))),,.}.|}}....,,},,...,,)))))))))))..))))),(((((....))))).,..........)))))))))))))).))..))....)))))))....)))).)))).)))))|{((..({(({......}}))}.,,.}}))))))))))))))))....(((((.(((..((((((({.{{,{,,,..{{{,{||}}|||{,(({(((({,....,|}|,.}))}),},.,}}},))))}|,.((({({{.{{{,,,,,)))}.|||{||,.{{.((((((((((..{(((.((..(((((((((..((.{,.{(,{(((.(((((,{,{....,}},...))))).)))))).,.}.))..)))))))))...)).)))})))).)))))){{{({.,...............}},,})))))....,)))))))))).)))))((.((((((((((..(((((....))))).))).))))))).))....))))))))),,||{{......}}}{{.(((((((((((..........((((((.......)))))).((((.......(((((..........(((((.{......).))))).,.((((((.(.(((...(((((((((..(((((......))))).))))}}....,..,.....,...,,((({....})))((((,..{{(((.((((((.{,....}}.)).)))).)))))))))..(((.((((........))))..))).}})....)))..}.)))))).)))))))))))))))))))).)}))))})))).)))))..............{(((((((....)))))))).....))).})))))))))))))..{{{(..(((....)))..))),.))))))))...).)))),,.))))((((((........)))))).....(((((((((...,.(((((((...))))))).,))))...)))))....((.(((((((((((.....,{..{{.((((.......))))..,}.,..........{{(,.((....)}....})})))).))))))).)))))))).)))))))))))).)}))).))))))).)))))).))))))...(((((((,,.{{{(((((,,((((((((.{,((((......))))..,}.)))))))).,,.)))),..|{|({..(((((((....)))))))......||||,......,)))...))))))).)))))))))))))...))))))).|||,,|,,|.{,}}}),))))..}},)))))))...)))))),..}))))))).)))...))))))))....,,,{{{{.....((((((((((..({,,.......,(((,...,}}}..(((.(((.{(((.{..(((((((.......))))))).,)))}})))))))..).))))))))).|||||..,))))}.,,}}....},)))))))))).))))))............(((((((..((..((((((......(((.{.(((((.((...)).)))))).))).....))))))(((......)))........))..)))))))..,|||,,..,,}}.))))),}),)}{((((({{((((...(((((((,{,,(({{(,(({{.,,,,,,||||..}}))),),,.,,}||,,|||}{,|},.,.}||{|||{{,,.,,...}}}}..,}),..,|(((((.((((((((......))).((((((.....(({....(((((((((((.,..........,,.||{||{.,,((((((((..(((......(((.((.{{{,(.{{,...,}}}})}).}},,)))......)))..))))))}}}}}}..|||,{{{.....)}}.)))|...{(((((((..((((...(((((.{{{{{{.....,,|||||}}},||..,,,,}}))))))..))))..)))).))))}},...,))))))))))))))))))))...}))))...))))),.))))))).))))))))))|(((......)))}..)))))).)))).)))).)}.(((({{(((((.((((((((((..((((..((((((.........(((.....(((((.......)))))......)))..........))))))))))..)))....))))))))))))))))).)}.)))))))).))))))))))...)))))).........{(((((.....)))))}....{((((.((....)))))))...})))))}.....((((((((((..((....((((((((....(((..(((((((...((((........,,,,........}}}}....{{{,{(((......))))))|,...((({..,{((,..((((((...))))))...,},,.....|}}.||}}...||,..,....,))....)))).))))))).)))...((((((...((.((,..,,.{(((({(({,..{(((...(((......((.{((((((((.(...((.(((,((...(((((({|.|{((|......,,{{{,......}}}}.......,,,.....(((((((..((((((.{{.....((((........))))......}}.)))))).)))))))}}}))))))))}).))).))..).))))))))}.))...))).))}},..,..(((((((({{....,.((((((((.((((.(((((((((((.((.......)).}))))))},)))))))..))))))))})))))))))}..|.{{{.,{....,,},.,,.,.,,}}},}}.,,})))).))))))).))...)))))).(((((((......))))))).....,,...{{{{,{{....((((.(((....{{((((((.......))))))........(((((((..........)))))))}}.....)))))))(((((.(((((((((.....((((({((,{((((({{{{{{.,,.,,,.,|||{{{,...}))),}}}|}|,)))}||},|||(({(((.{{,{{.{{{{..((({.((((((((((.,(({({.{(((({.,..((((((((({..,(..((((......))))..))))))))))).,{((((..|,,,,..,((({{.{,|,,......).).)}))).....,})}))))){((((.(((........))).))))).})))}}..,),,,)),.,)))))),)})))))}.,|||..{{||{,||}}},......}},|||,,...,)),))))))))).))))),,}}}}}.....(((((........)))))))))))))}),)))))))))).)))))))).,,,))),))))))))))..)))))))))}.........,|},,.((((((((((((.((((({,((({((((.,{{{{{{||(,|,,,{{....{({{..,,.,,,,,,,,.,,,..........|||||}}})}.,{{,{{{((((,((,,..}}.}))}.,,,..||||}...}}))),.(((.((((..{{,.((((((((......)))))))).}}..))))))).......}}}}}...))))))))).)))))))))))).......)))))))))((((((((......),}))))))((.((.(((({(,.((((.(,{(((.(((.((((((((((((........)))))))))...))).).))..))))).)))))))))).)).))..........)))))))...))...)))))...)))..)))))..((((........))))....((((.(((((((..........)))))))...)))).((((((((....,,,,))))}}))..))).))..).)).))))))})},,},..}))).))).)))))))...,{,(((((((((.(((((((((((.......))))))))))).)))...{.((((({...}))))).}.......)))))}.,,,.))).((((.(((((.{..........}.))))).)))).

Transcripts

ID Sequence Length GC content
AGGCUUUUGGCCACUAGGAGCUGGCGGAGGUGCAGACCUAAAGGAGCGU… 15657 nt 0.4590
Summary

The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]

Forensic Context

A study in humans demonstrated that the LRP2 exhibited a Gini impurity score of 0, being present in most pure urine samples and in some mixtures containing urine while being absent in mixtures without urine, supporting its role as a discriminatory protein for body fluid classification [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].