Basic Information

Symbol
LRPAP1
RNA class
mRNA
Alias
LDL Receptor Related Protein Associated Protein 1 Alpha-2-MRAP A2MRAP HBP44 RAP Low Density Lipoprotein-Related Protein-Associated Protein 1 (Alpha-2-Macroglobulin Receptor-Associated Protein 1) Low Density Lipoprotein Receptor-Related Protein Associated Protein 1 Alpha-2-Macroglobulin Receptor-Associated Protein Low Density Lipoprotein Receptor-Related Protein-Associated Protein 1 39 KDa Receptor-Associated Protein A2RAP MYP23 MRAP
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_002337.4
Sequence length
10446.0 nt
GC content
0.5288

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-4480.00 kcal/mol
Thermodynamic ensemble
Free energy: -4645.40 kcal/mol
Frequency: 0.0000
Diversity: 2245.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((((..((((((((.(((((((.(((((((....((((((((.(((((.((((((..(((((((((((.....(((((....)))))....))))...)))))))(((.((((((((((((((..(((((...(((.((((((....((((.(((.....))).)..))).......(((((...))))).)))).)).)))...).).)))..)))).))))))))))))).((((((((((...((..((((......((((.(((.......))).)))).............((.(((.((((((.(.(((((((.(...(((..(((.........)))..)))...).))))))).)))))))...))).)).)))).))..))).))))))).(((((..(.((((((((((.(((((.((((((....(((.((((......)))).)))...((((((.((((((.(((...(((....(((((...((((.((..(((.((.....)).))).)).))))....((((.(((...(.((((.(((((((((.....((((((((((....))..)))))))).........(((((.(((((((.((((..(....)..))))..)))....(((((((((.(((((((((..(((((.((((((((...(((...((((((((......((((...)))).....))))))))((((((.((((.(((((.((((......)))).........)))))..)))).)))))).(((((...(((((.....)))))..)))))(((((.(((((((((((((..((((..((((.(((.(((((((((........)))))....................(((.(((((((((((((((((((.((((((.(((((.....))))).((((((((.((((.....((.((((.(((.(((((((..(((((((((.((......)).....((((((((...(((((.........((((.(((....))).))))..(((.(((((.(((......))).))))).))))))))...)))))))))))))))))(((((.((((.((.....)))))).))))).(((.((((((..(((((..((((((((((......))))..)))))).))))))))))).))).........))))))).))).)))).))))))))))))))(((((.(((((.((((((((..((.....((((((((...((((.((((((.......)))))).))))....))))).)))......))..)))))))).((((..((((......)))).))))((((((....)))))).((((((((..........(((((.......)))))...........(((((((..((((.(((((((.(((((.......((((((.((((.........(((((((.(((((.((((((((((.......))))))))))....(((((....))))).((.((((..((..........)).)))).))...((((((.((((((((.(((((.(((((((((((((.(.(((((((...)))........(((((((....)))).)))..)))).).)))))))...)))).))((((((..((((((((((((((((.(((((((((.((.(((.(((((((........((((.(((((((((.((...(((((.....((((((((..(((((((((((((...........(((((.....(.((((((...)))))).)...))))))))))))))).........((((.....)))).)))..))))((((.((.((((.((((((..(.((((....(((((((((.....)))))))))...(((((.((((((((........))))))))))))).)))).)..)))))).))))..)))))).))))....))))))).)))))).)))..))))(((((((.((((.(((((((.(((........))...(((((((((.....)))))))))((((((((.(((((.((.......))))).)).))))).)))..).))))))).)))).)))))))..(((((.(((((....(((((((((.....)))))))))...(((((.((((((((........))))))))))))).)))))((((.((((.(((((((.((((.(((..((((.((((((((((.....))))))))).))))).))))))).)))).)))..)))).)))))))))))))))).))))).)))))).))).)).)))))))))..((.((((((((((......))))))))))))......)))))..)))))).....((((.....((((..(((...((((...))))...)))))))...))))))))).)))))))))))))).))))).))))))).))))..))))))))))))))))))))))..)))))))))))))))((((((.((((..........(((((.(((.(((((.(((....))).))))).))).))).))(((........)))......(((((((((((((......((((((((.....((((((..(((((((......((((............))))......)).((((((...(((((..(((.(((....)))((((.((((......((((((((((((((((.((.(((((((.(.((((((((((((((.(((....((((....)))).))).......((((((....((((((.(((...((....))....))).))))))..))))))........((((((((((.(((((.(((((.(((((..(((((.((((((((((.(((.(((((........((((...(((..((.(((((((((.....)))))))))..))..)))...)))).((((.(((((((((...(((((....)))))......))))))))).))))...)))))))).)).)))))))).)))))))))).)))))...(((...(((.(.(((.((((...........))))))).).)))..)))(((((...(((((....))).))...))))).))))).))))).)))))))))))).))))))).))))))))(((((((....(((.(((((.....((.(((((.(.((((....(((.((((..(((......)))..)))).)))...))))).))))).))))))))))...)))))))...(((((((.(....).)))))))(((((((((........(((((((((((((((.(((.((((((..(((((((((((........((((((.((((..((((.(((((((....................((((.((((..(((.((((........((......)).)))).)))))))))))(((.(((((((....))))))).)))..((((((.......((..........)).......)))))).)))))))..))))..)))).))))))((((((((((.((....))))).)))))))..............(((...((.........))...))))))))))))))..)))).))..))).))))).).)).)))))))((((((................(((((.......)))))((((((((.(((((.((..(((((((((.....)).))))))).))))))).)).))))))))))))(((((......))))).....(((....(((....))).....))).)))))))))......)).)))))))))(((((((...)))))))...(((((((..(((.(((....(((.....((((....))))......))).))).)))..))))))))))))))....))))))))....)))..)))))..)))))).......)))))....))))))....))))))))......))))))))))))).(((((((((((.(((((.........))))).))))))...)))))...........)))).))))))((((((((((..((.....))..))))))))))......)))))...)))))...((((((((((..((.....))..))))))))))))))))..))))..))))....((((((((((..((.....))..))))))))))....))))))))))))))....((((((((((..((.....))..))))))))))....((((((..(((((..(((.((..(((((.....((.(((.((....)).))).)).)))))..)))))..))).))..)))))).)))).)))))))..))))))))))..))).))))..)))))..((((((((((..((.....))..)))))))))))))..))).))))))))))...((((((((((..((.....))..))))))))))....(((((((.(((((((.((((((.(((.((((((((.(((.((....)).))).).))).....))))))).)))))).))).))))..((.(((.((....)).))).))..((((.((((((((.((((((.(((.((((((((.(((.((....)).))).).))).....))))))).)))))).))).)))).)...)))).((((((((((....(((........)))....)))))))))).(((((((((((((((.(((((((((.......))))........)))))..))))))))....)))))))....(((((((((..(.(((((........))))).)...)))))))))....)))))))......................))))))).)))))..........))))))......(((((........))))).)))).)))))))))))))).))))))))))))...(((...((.((((...)))).))...))))))))...))).))))))))).)))))).((((((.(((((.(((((((((....)))))))........)))))))..))))))....((.(((((((((.((((((((((....(((((((((((((((((.....((((((((((((..(((((.....))))))))))))((((.(((((.....))).)))))).)))))....)))))).)))).(((((...(((((......)))))..)))))....(((((.....)))))....(((((((.((((((.((((((.....))))))..((((((..(((((........)))))..(((.((((((((((..(((((.....)))))....)))).(((....))))))))))))........))))))..(((((......)))))..)))))).))))))).((((.(((((.....)))))..))))(((((((((((((((((((((((..(((((..((((.....)))))))))..)))))))))).(((((...(((((...((((.......)))).))))).)))))....((((((((((....))))))))))((((((.((((((((((.(((((.(((((((.((((((.(((((((((((((((((((((((.((((...((((.((.(((((.((((((((((((((((((((((.(((.((((((((((((((..((.(((((.((((((((((.((((((((((((((((((((((((((((((((((.((((((((((((.(((((((((((..((((..((.(((((.((((((((...(((((((((((((((((.((((.((((((((((((((((((((.((....(((.((((.((((.(((((((((((((((.(((.((((...((..((((((..(..(((..(((.(((....)))))))))...)..))))))..))....))))..)))...............(((((((((((......))))).))))))(((((((...((((((((.....((.....(((((((((((......(((..(((((((....(((..((((.........))))..)))(((((((........)))))))...(((((((.((((.((((.((((.((((((.(((.(((((....((((..((..(.((((((.............((..(((....)))..)).............)))))).)..)).))))....)).))).))).)))))).)))).)))).)))).))).)))).......)))))))..)))........)))))))))))......))..))).)))))........)))))))(((((.((((((((((......((((((...(((.(((........)))...)))...))))))(((((((((.....((((........))))((((((((((((......(.(((((....(((((((.((..((((((....)))))))))))))))...))))).)......)))))))...)))))(((((.((((.((((......)))))))).)))))...((((((((.((((((...))))))))))))))....))))))))).........))))))))))..)))))))))))))))))))).)))).)))).))))).))))).))))))))))))))).)))).)))))))))))))))))...)))))))).))))).))..))))..))))))))))).)))))))))))).))))))))))))))))))))))))))))...((((((((....))))))))((((..(((((...(((((......(((((((((.((.(..(((((((((((..((((................)))).))).))))))))..)))(((((((...)))))))..)))))))))...))))).....))))).))))(((.(((((.........(((((((((((.(((....)))))))..(((((.(((((...............(((....((((((.....))))))...)))....(((((((......)))))))..................(((((.((((((...(((((......)))))...)))))).))))).....))))).))))))))))))............))))).)))(((((((((.(((((((((((((((.(((((((((((((((((((((.(((((((((((((..(.(((((((((((((((((((((((((((((((((((((((((((((..(((((((((((((((....(((((((..((.((((((.(((..((((((((((((((((((((.(((((((((((((((((((..(((((((((((((((..(((((((((((((((((((((.(((((((((((((.(((((((((..(((.....(((.((((.(((((((((((((((((((((((((((...))))).)))))(((((((((((((..((((((....))))))..)).))))))).)).))......(((((((.(((...)))...)))))))((((.((((....................((((((((((((.(..((.((((((((((....((((((((((((((((((((.(((((.((.(((((.(.(((((.(.((((.(((((((.(((((.((((((((((((...(((((((((.(((.(((((((.(((...((((((((((((((((((((((.(((((((..................(((((((.......))))))).(((((........)))))..(((((.((((....)))).).....))))..(((((((...)))))))((((.(((.(((((.((((((..(((((..(((((((((.((((..((((((((.((.((((.((((((....))))))..((((((((((((..(((((((((.......((((((((...............))))))))((((((..((((((..(((..((((.(((.(((((((..((.......))))))))).)))....)).)))))))))))))))))...((((.((((..((.((((((.(..((((.(((((.((....)).)...)))).))))...).))))))))..)))).))))..)))).)))))..))).))))).)))).(((.(((((((((((((..(((((((((((((((((....)))))).....)))))..(((((((((((....(((.((((((((.(((((.((((((((...)))((((......)))).(((((.......)))))(((.(((((...........))))).))).((((....))))((((.......))))(((((((........)))))))....((..((((.((((((..(.((((((((((((((((....))))))).((.....))..)))))).))).).)))))))))).))((.(((((.(((((((...)))))))...)))))))...)))))))))).)))))((((((((((((((((.(((....)).).)))((((((((.....))))))))((.(((((((....((((((((.............)))))))).((((((((((.....)))).))))))..)))))))))..)))))))...))))))..)))..)))))))))))))).((((........))))............))))))))))))))).))))...))).....)))).)).)))))))).))))....)))))).)))...)))))...)))))))))))))).))))........))))))).))))))))))))))))))))))...))).))))))).))).)))))))))...)))))))))))).))))).))))))).)))).).))))).).))))).)).))))).)))))))))))))))))))).)))))))))).))..).)))))))..)))))...))))))))................))))))))))))))))).)))).)))...)))))))))))).))))))))))))).)))))))))))))))))))))..)))))))))))))))..))))))))))))))))))).))))))))))))))))))))..))).))))))..)).))))))).....)))))))))))))))..))))))))))))))))))))))))))))))))))))))))))))).)..))))))))))))).))))))))))))))))))))).))))))))))))))).)))))))))..)))))).)))))))))).))))).))..)))))))))))))).))).)))))))))))))))))))))).))))).)).))))...)))).))))))))))))))))))))))).)))))).))))))).))))).)..))))...))))).)))))).......)))))))))))))((((((.((....(((......)))....)).)))))))))))))))))).)))))...))))))))).))...((((........))))........))))..)))))))..(((..((((((....((((((.........))))))...))))))..))))))))))))).)......))))).(((((.((((.....((((((((((((.((..(((((((((.(((((.((((.((((....)))).))))..)))))))..)))))))..))....)))))..))))))))))).)))))((((((...((.(((.....))).))..)))))))))))).))))).)))).))))..)))))))....(((((....)))))....................)))))))))))..))))..)))).(((((......(((((..((((......(((.(((((............(((((((.....(((((...))))).)))))))))))).)))))))..))))).......)))))(((((....)))))...((((((((..(.....)..)))).))))...((((((..((((((............)))))))))))).....)))).................................
Thermodynamic Ensemble Prediction
{{{(,((((..((((((((.(((((((.(((((((....(((({(((.(((((.((((((.,(((((((((((.....(((((....)))))..}.))))...))))))}{||.((((((((((((((..((({{...(((.((((({....({({.(((.....))).}},})}..,,...(((((...))))).}))).)).)))...}.).)))..))))}})))))))))}}}.((((((((((...((..((({......((((.(((.......))).)))).............|{.{{(.((((((.(.(((((((.{.,.(((..(((,......,.)))..))),..}.))))))).)))))))...))),}}.)))}.}}..))).))))))).(((((,.{.((((((((((.(((((.((((((....(((.((((......)))).)))...((((((.((((({{(((...(((....((((,...,{(({({.,{{,.|||||,,,|{|,,{||{||||{,..,({{.(((,..{.{(((,({(((({((,,,..(((((((({(....,},.)))))))).,.,,,,,{{((({,(,,(,((,,((({.,.,{{|,{||}|{.|||,{{,(((({(((({(({((((((,,(((((.((((((((...((({..((((((((,.....((((...))))...,.))))))))((((((.((((.(((((.{,({,{{...,,},}}}.,....)))))..)))).)))))).(((((...(((((.....)))))..)))))(((((.(((((((((((((..((((..((((.(((.(((({((((........))))}..,,.......,....,{,.{{.((((((({((((((((((((.(((((({(((((.....|||||,((((((((.((((.....((.((((.(((.(((((((..(((((((((.{(,.....)).....((((((((.,.(((((........,((((.(((....))).))))}.{((.(((((.(((......))).))))).)),)))))...)))))))))))))))))(((((.((((.((.....)))))).))))).(((.((((({.,(((((..((((((((({......})))..)))))).))))))))))).))).........))))))).))).)))).))))))))))))))(((((.(((({.((((((((..{({{.,,(({(((((...((((.((((((.......)))))).))))....))))).})),,.})}}}..)))))))).{(((..((((......)))).)))}((((((....)))))).((((((((..........(((((.......)))))...........(((((((..((({{((((((({(((((.......((((((.((((.........(((((((.((((((((((((((({.{....,))))))))..}}}}{((((....))))}.{{.((((..((......,,..)).)))).)).|.((((((.((((((((.(((((.{((((((((((((.(.(((((((...))),((((({{{(({....}.))))))))),.)))).).)))))))...)))).)}((((((..((((((((((((({((.(((((((((.((.(((.(((((((.......{((((.(((((((((.((..,(((((,{{.,,{,.((((..(((((((((((((...........(((((.{...(.((((((...)))))).).}.))))))))))))))),|,,,,.,.{{{{....,)})).)))..))))((((,((.((((.((((((..(.((((....(((((((((.....))))))))).,.(((({,((((((((........))))))))))))).||||.}.,||||||.||||.{||||||,|}}},...,}}}}},.}||||||||}..,}))||||||{.((((,(({((((,,((.......}}}},.||{|||||{,,,..)}))))))).||||{||,||||{.{{.......})}}}.||,|||||,}}}..),))))))).))||,||}||||,.((,,,.,,,||}},.||{|||||{,,,,.)}})))))).}}||{||,||||{{||,......,))))})))))))),)}}})|||(.((((.(((((((.((((.(((..((((.((((((((((.....))))))))).})))).))))))).)))).)))..)))).)},}))}}}))))))).))))).)))))).))).)).)))))))))..((.((((((((((......))))))))))))......)))))..)))))}.....((((.....((((,.{((...((({...}))).,,}})))))...))))))))).)))))))))))))).))))).))))))).))))..))))))))))))))))))))))..)))))))))))))))((((((.((((..||..,,{{(((((.(((.(((((.(((....))).))))).})|.))).||{({..,|....}},......(((((((((((((......((((((((...,.((((((..((((({{......((((..,.........))))......}}.((((((.,.(((((.,(((,((,....)))((({.{(((......((((((((((((((((.((.(((((((.(.((((((((((((((,,......((((....}}}}.{||,,..,{,((((({,,..((((((.(((.{.((....}}|...)}).)))))).,})))))....,,,.{(((((((((.(((((.{((({.(((((..(((((.((((((((((.(((.{{{{,.....,{{{({({{..,,.}||,|||||||||..,..},}}}}}}|{,|},||||,..|{{{.{{((.((((((({{...{((((....)))),.,,...))))))))).)))),}}}}}},))).)).)))))))).)))))))))).})))}(({(((,..{((.(,(((,({((.......,,.,)))}))),).})),,}}.|,,|}))}|||{{...{||}.,},,.,},}}.))))).))))).)))))))))))).))))))).))))))))(((((((,...(((.(((((.....((.(((((.{.((((....(((.((((..(({......}))..)))).)))...))))}.))))).))))))))))..,)))))))...(((((((.{....}.)))))))(((((((((........(((((((((((((((.(((.((((((..(((((((((((.....{{{(..((((((({.,((((,,((((({....................|||,.,,,}|||||.((({........||......||,}}}}.}),||||||,.{((.(((((((....))))))).))),,}|,,,|,......|{....))....,)}}}}}}..)))).{{{||,,|{.|||,....))})},((,((((((((((.{{....)}))).)))))))}}..},}},.....||,..,||.........}}...,,,)))))))))))..)))).))..))).))))).).)),}))))))((((((.................,,{,.......)))||((((((((.(((((.((..(((((((((,...,)).))))))).))))))).)).))))))))))))(((((......)))))..,,,{{{,,|,(((....)))..,..}}).)))))))))...,..,).))))))))}(((((((...)))))))...(((((((..(((.(((....(((.....((({....)))).....,))).))).)))..))))))))))))))....))))))))....))),.)))))..)))))).......)))))....))))))....))))))))......))))))))))))).{{{{{{{((({,|{{{|,,,....}}))}}),)))))),..))}}}......,....)))).))))))((((((((((..((.....))..))))))))))......}}}}}...))))).,,{({{{(((((,.{{.,,.,||..}}}}}))})))})))),,))}}..)))}..,|{({{{(((((,.{{.,,.,|}.,}}}}}))))),.,.))))))}}}}))||,,||||({,((({(|.{{,||.{||.,|}}}}))}))),}}}}||||.,|(({({{.{{{(({.(({,{{{({{{{.(((.{{....)),))).}.,)),.,..)}})))).}}||||.|||.|}||||||,|||,||,,,,})}})),,..}}}.,.,|||||||.||||({.(({.{{{({{{{.{||.{|.,,,)),))).}.,}},.,.,)}}}))}.||||||.|||.|||||||{.|||.||,,,,))}))),}.,}}|.|.,|||||||.||||||.|||.|||{{{{{.{||.{|.,,,)),))).}.,)),.,.,)}}}))).||||||.|||.||||{|{{.|||.{|,,,,))}))}.}.,}||,|.,|||||||.||||||.|||.||||{|{{.|||.{|..,,)),))).}.,)),.,,,)}})))),}}||||.|||,|}}||,,,.})),.||||||||||}}}.,||}.}}}}}})))},{{||||,|}},},{{{{{{{((((((((.((((((({{.......}}}}........)))))..)))))))}....))))})),)}..||||||||.,}}}},,}}}...}}}}},)).}}}})),,,)))).)))})}))))}.},,,,,....,....,,...})))))},))}))),,.....,,)))}}}.}}},,|||||..,,,...}||||.||}}||}}||||}}}}|||,}}}}||||}}},.,}|||.|,||.||||},.}))).})),,))))))))...))).))))))))).)))))).((((((.(((((.(((((((((....)))))))........)))))))..))))))....((.(((((((((.((((((((((....((((((,((((((((((.....((((((((((((..(((((.....)))))))))))}((({.(((((.....))).)))))),)))))....)))))).)))).(((((...(((((......)))))..)))))..,{(((((.....}}}}|{|..{((((((.((((({,{{{{((,,...}|||||,,((({{{.((((({,,,{{{,.,{|,,...,}..}}}}}))))).|{|{|}},|,},|||.|{{||||.{(|.{{{{,,{.{((,,,.}}}.}..}))),,}..|,|||}}}}}}),,)}.})))))).)))))}|,{,|},{|{{{..,..)}})).,}}}|{((((((((((((((((((((((..(((((..{(({.....}}}})))))..)))))))))).(((((...(((((,{.((((.......))))}))))).})))),,...,,((((((({{,.||},||||||{,,,,...,{{{(,,,(.(((((.(((((((.((((((.(((((((((((((((((((((((.((((.,.((((.{(.(((((.((((((((((((((((((((((.(((.((((((((((((((..((.(((((.((((((((((.{{((((((((((((((((((((((((((((((((.((((((((((((.(((((((((((..((((..((.(((((.((((((((...(((((((((((((((((.((((.((((((((((((((((((((.((....(((.((((.((((.((((((((((((((((.(((((({{{.((..((((((..{..{((.,(((.((,....))}))))))...}..))))))..))...,(((((((((((((...........(((((((((((......))))).)))))).(((.((((((....,((((({({((({{((((((...{,,.{{..,.,(({(,,,{.......}},|{{{{{(({(({{.(({{{{{{{.....,},.,.,,.,{((((((((({((((((.((({.((((.((((.((((((.(((.(((,(,..(({((,,((....(({.............{{{((..,,,....||,..,..,}..,......}))))}}....)).))))})..)).))).))).)))))).)))).)))).)))).})}.)))).....((((.(((((.{(((((...,,.(((({....})))).,....)))))}.............))))).))))....)))))))))}.,}}||||,}}}}.....}}}}))}}}},}.....},..)))).,),,)).,,,.}}))))))..........))))))))))}....))))))))).......{(((((((((..((((({....,))))))))))))))...))))))..)))))))|(.((.{{{.|{{(((((.((((.((((......)))))))),))))}}}}|.}}},|}.||{,,....)))))))).,....((((...(((((.{{....}}.)))))...)))).,).)))))))))))))))).)))).)))).))))).)))))}})))))))))))))).)))).)))))))))))))))))...)))))))).))))).))..))))..))))))))))).)))))))))))).))))))))))))))))))))))))))))))}|(((((((....}))))))},{{(,,(((((...(((((....,.(((((((((.,,.{.{(((((((((((..((((................)))).))).)))))))),.),}(((((((...)))))))..))))))))).,.))))).....))))).))),(((.(((((........,(((((((((((.(((....)))))))..{((((.(((((.......,..,....{((..{,{{,{((,,,,.|}}})}),,)))....|{{((((......,,}}},,....,.......{{,...(((((.((((((...(((((......)))))...)))))).)))))..,},))))).))))})))))))............))))).)))(((((((((.(((((((((((((((.(((((((((((((((((((((.(((((((((((((..(.(((((((((((((((((((((((((((((((((((((((((((((..(((((((((((((((.{{.(((((((..,,.((((((.(((..((((((((((((((((((((.(((((((((((((((((((..(((((((((((((((..(((((((((((((((((((((.(((((((((((((.(((((((((..{{{..{..(((.((((.((((((((((((((((((((({(((((...))))).}}||((((((((((((((..((((({....})))))..)).))))))).)).)))},...(((((((.{{(...,}}...)))))))...,..(((((({..{({...,((.....((((((((((((.(..((.((((((((((....((((((((((((((((((((.(((((.((.(((((.(.(((((.(.((((.(((((((.(((((.((((((((((((...(((((((((.(((.(((((((.(((.,.((((((((((((((((((((((.(((((((....,{{...........(((((((.......))))))).(((((........)))))..(((((.((((....)))).).....)))).,(((((((...)))))))|(((.(((.((((((((((((.{(((((..{((((((((.((((..((((((((.((.((((.((((((....)))))).,((((({{{{|||,}|((((((((.......{(((((((,{,.....}},....)))))))}((((((..((((((,.{(,.,((({.(((.(((((((..((.......))))))))).)))....)}.}})})))))))))))))...((((.((((..((.((((((.{..((((.((((,.((....)).,...)))).))))...}.))))))))..)))).)))).,)))).))))}..,,}.)}||||{|||{,.,.((((((((((((,,,(((((((({({((((((....))))))....,)||||..(((((((((((....(((.((({((((.(((((.(({(({{.|.|||}{{{{.,.,,.}}))|((((({.{{{,.|||||({(,((((({{,,......,})))).|}}.((((....)))),(((..{,,..,}})||||||{.{{,,,{||}||||,....{{.,({({{((((((..{,({,(((((((((((((....))))))).((.....}),.)))))).})).,.)))))))))},||({.(((((.(((((((...)))))))...)))))}).,,)))),})))),))))|||{{|||||{||{|||,|{(,,,,|},|,|||((((((((.....))))))),||,|(((({(.{,.(((((((|..,........,,)})))))).((((((((((.....)))).))))))|.}||||},,,..))))))),,,})))))),)))..)))))))))))))).||||,{{.....}}}),,..........)))))))))))))))}}))).}})},..,}})))).)).)))))))).))))....))))))}}))...))))),}.)))))))))))))).)))}........))))))).)))))))))))))))))))))).,.))).))))))).))).))))))))).,.)))))))))))).))))).))))))).)))).).))))).).))))).)).))))).)))))))))))))))))))).)))))))))).))..).))))))),.))))),,)})}).)))))))....,)},,,.}))))))))))))))))).)))).)))}..)))))))))))).))))))))))))).)))))))))))))))))))))..)))))))))))))))..))))))))))))))))))).))))))))))))))))))))..))).))))))..,}.))))))).,}}.)))))))))))))))..))))))))))))))))))))))))))))))))))))))))))))).)..))))))))))))).))))))))))))))))))))).))))))))))))))).)))))))))....,})}.)))))))))).))))).))..)))))))))))))).))).)))))))))))))))))))))).))))).)}.)))).,.)))).))))))))))))))))))))))).)))))).))))))).))))).).,))))}}}),})}}))))))}}}....)))))))))))))|{{{{{.{{....(((...,,,}))..,.)),)))))))))))))))))).)))))...))))))))).))...{{{{........||||...,},}.))))..)))))))..(((..((((((....((((((.........))))))...))))))..))))))))))))).}...,..))))).(((((.((((.....((((((((((((.,(..((((((({(.(((((.((((.((((....)))).))))..)))))}}..)))))))..}}....)))))..))))))))))).)))))((((((...((.(((.....))).))..)))))))))))).))))).)))}.))))..)))))))....(((((....))))),.............,.....)))))))))))..))))..)))).{((((...,{,(((((..((((,.....(((.(((((.{{{....{{{.(({{{((,.,..{{(((...)}}})})))})))))))).)))))))..))))).,,,...))))}{{{{{..,.}})))}},((((((((..{.....}..)))),,)))...((((({..((((((............))))))))))))....,)))).................,,,,,,..........

Transcripts

ID Sequence Length GC content
GCAGAGGAAGAUGGCGCCGCGGAGGGUCAGGUCGUUUCUGCGCGGGCUC… 10446 nt 0.5288
Summary

This gene encodes a protein that interacts with the low density lipoprotein (LDL) receptor-related protein and facilitates its proper folding and localization by preventing the binding of ligands. Mutations in this gene have been identified in individuals with myopia 23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]

Forensic Context

A study in humans demonstrated that the mRNA of the LRPAP1 was significantly upregulated in salivary extracellular vesicles from emergency department patients with acute head trauma compared to healthy controls (p=0.0102) [Cheng et al. DOI:10.1002/jcp.28139]. A study in humans demonstrated that the LRPAP1 gene was downregulated during long-term (0 to 12 months) weight loss in subcutaneous adipose tissue of weight losers [Bollepalli et al. DOI:10.1038/ijo.2017.245].