Basic Information

Symbol
LRRN4
RNA class
mRNA
Alias
Leucine Rich Repeat Neuronal 4 DJ1056H1.1 C20orf75 NLRR4 Leucine-Rich Repeat Neuronal Protein 4 Neuronal Leucine-Rich Repeat Protein 4 NLRR-4 Chromosome 20 Open Reading Frame 75
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_152611.5
Sequence length
2935.0 nt
GC content
0.6286

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1233.00 kcal/mol
Thermodynamic ensemble
Free energy: -1279.86 kcal/mol
Frequency: 0.0000
Diversity: 768.58
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((......)))))..(((((..((((((((.......(((((((((..(((((.(.(((((((.(.((.(((((((((((((...(((((((((((((..(((((...((((((((((((.(((((..(((((((.......))))..................)))..))))).)))))))))))).((.((..(.((((......(((....)))...))))).)).))...((((.........))))(((((.(.(((..(((((((.(((((.((((((..(((((......((((.((......)).))))))))).)))))).))).((((((((((((.(((((......))))).).)))((((.(((.((((((((..((.(.((.((((((((.....(((((((((..(((.....)))(((((((((..(((((((((..(((((...)))))........(((((((........)))).)))..((((((........)))))).....))).))))))))))))))).....((((.......))))..((((((((((....((((((((((.(((.((((((((.((.((..((((.............)))).)))).)))))))))))..)).))))))))((((.(((....))).))))...((((((((((((....)))..)))))))))))))).(((((.(((((.((((..(((.(((((((((..............)))))..)))).)))..))))((((((((((.((.(((((....((((....))))....)).))).)).)))))))....)))))))).)))))......))))).(((((...)))))(((((((.((((((((..(((....)))..(((((...((((((((.....))))..))))....((((((.((((((((((((((.(((((...))))).)))))..((((((((.(((((...((....))...))))).........((.(((((((....(((....((((.......))))(((((....)))))..((.((((((((..((((..............(((((.(((.......))))))))..........((.....)).......)))).)))))))).))..((.((((.(((((....))).)).)))).))(((((((....))))))).))).....)))).))).)))))))))).))))).)).....))))))))...(((.........)))...((((((((((((.............))).))))).)))))))))....)))))))).)))))))..........))).))))))....))))))))))).))))))))))))).....(((((...(((((((......).)))))).)))))........))))...(((..((..((((..(((((((((((.(.((..(((((((((.....))))))).))..)).).)))).)).)))))))))...))..)))....))))))))..)))))))))..))).)..))))).((((((.((...((......)))).)))))).)))))...)))))))))))))...)))))((((.......(((((((((....((((........))))..(((((....))).))....))))))...))).......)))).......)))))))).)))))........)))))))))))))))))))).((((((((.((((....((((((((((((((((((...(.(((.(((((..(....((((.(((......))))))))..)))))))).)..((..((((((.(.(((....))).)))))))..))(((((((((.((((.((((.((((((((.(((.(((...((((.........(((((((..(((((((((((......(((((....))).))..(((((..(((.((((((..((.....))..)))))).)))))))).(((((......))))).((((((((((....)).....(((((((((((.......(((.((((..((((((.((........)))))))))))))))))).))))))))(.(((.(((..((((((.....(.((((((((...((((((.((.....))))))))..)))))))).)))))))..)))))))..)))))))))))).)))))))..)))))))((((.((((((((..((.((((((.(((((((((....))))))...(((......)))..(((((.((((...)))).))))).)))..)))))).))..)))))))).))))....((((((...............))))))......(((((((.((((.(((((...))))).))))(((.((((((......))..)))))))...............)))))))................((((..(((..((((..(((....)))...))))..))).))))....))))..))).)).).))))).))).))))))..)).)))))))))))))))))))))).......((((....))))..((((.((((....((......))........)))).))))(((((((((((......(((....((((........)))).....)))...((((.((.((...)).)).))))))))))))))).((((..((((((.((((.......)))).)))))).))))..............)))))))))..))))))))..))))))))........((((...........))))(((........)))......))))).....
Thermodynamic Ensemble Prediction
.(((((......)))))..{{(((..((((((((.......(((((((((,.{((((.(.((((({{.{.((.(((((((({((((.,.(((((((((((((..(((((...((((((((((((.(((((..((({(((.......))))||.,....,...,.....)))..))))).)))))))))))).({.{{..{.({{{......{{{....))}...}}))}.},.||...((((,........}})){((((.{.(((..((((((({((((,.((((((..(((((,,,...|||(,((,.....})})))}))))).)))))).)))}((((((((((((.(((((......))))).).)))((({.(((.((((((((..((.(.((.((((((((.....(((((((((....,.....((((((((({((,{(((((((,.,.(((({...})))).,....,.(((((((........)))).))),,((((((........)))))),,.{{{||.|},|)}|)))))||}|,...{({(|,.....|||,..{{.|||{,((((..(((((((((({((,{((((((((.((.((..((((.............)))).)))).))))))))))).})).))))))))}})).,.)),}}|{(((((,(((((({{..|}||||{....|.{|,|((.((((((((.,((((,....}},,}....}},).)))))))).}},}}.,...}})))}...))))}))).}))))))||||}}|}))),,,}||}.}}))))|,,{||{|{{,{||{|||{|,{{|...)),,.}))},,..)}}}}...}},))))))}.(((((...)))))(((((((.((((((((..{{(.,..}}|,,(({((,..{{((((((.....))))..))}),.,,|||(((.({(((((({(((((.(((({...})))).)))))..{{{({{((,(((((..,(,,,,,,,.,,|}|||.........((.(((((((...,{{{....||||.......}}}}(((((....)))))..((.((((((((..((((..............((((({(((.......))))))))....|,....,,.....)).......)))).)))))))).))..{(.((({.(((((....))).)).}))).)}(((((((....)))))))..,,.....)))).))).)))))))))).}))}}.||,....},}}})))...|||.,,...,.,}}},,,|(((((((((((..,..........))),,)))).)))))))))....)))))))).))))))))))))}....))).))))))....))))))))))).))))))))))))).....(((((...(((((((......).)))))).)))))......,.))))...{((..{{..((((..(((((((((((.(.((..(((((((((.....))))))).))..)).).)))).)).)))))))))...}}..)))....))))))))..)})))))))..))).,..))))).((((((.,{,,.((......)),),)))))).)))))...)))))))))))))...}||}|(((({.,...,((,{{((((....((((........))))..({(((....))).))....))))))}}}),)}......}}},...,,,,)))))))).))}}},.......)))))))))))))))))))).((((((((.((((....(((((((((((((((((((.{(.((({((((,...}}}}||,,{(((......))))||,,,,|{||||((((,.{{..{{||||.{.{{(,,,,|}}.||}||||.{|(({((((((({{{{{{{((({({{,,,,{||||}..,.}}}|.,,.....,|,((((((|,,{({((({{((,{,,.{,(({((....}}},||,,(((((..(((.((((((..((.....))..)))))).)))))))).(((((......))))),{((({((({{,...}|...,|(((((((((((...,..,({{,{{(((((((,(({(({.......))),))).))))))),}}.}},}}}})|,|{{.(((,,((((((.,,,,(.((((((((...((((((.((,...,))))))))..)))))))).)}|}||}..}}}}}},.,||||||}}}}||,}}}})))..,))))))|||},||||||||))|)})))|)|})}}||||{({{.((((((((,,(((.{.,.{{(({{((,,({({,,..,)),})))))))),)}))))))).)))))))))|||{...........))))...)))).,,.}})))}}}}|}}|,.(((((((.((((.(((((...))))).))))(((.((((((......))..})))))).....,.........)))))))......}|}}|||,.,((((..{((({{(({..(((....))),,,}}},.,}}),)}))...,.|||..,,.,)),}.}})))))))})))))}..},..)),))..)))))))))))))).......((((....)))}..,{||.{(({,..,{{,{{{{{({...{,{,.({({{{{||{,..||,},}}},.},})),......}}}}}},...))}(((.{(((((.(((((...}))))..)).)))).))),,|}},}||||{(,..((((((.((((.......)))).)))))).}}}|{|........,,.,)))))))))..))))))))..)))))))).,,,.,.{((((...........))))|{{,.......}},......)))),.....

Transcripts

ID Sequence Length GC content
AAAGACAACAGCGUCUUGAUGGGAAAGGAGGAGCAAUGGGAAAGACUGG… 2935 nt 0.6286
Summary

Predicted to be involved in long-term memory. Predicted to act upstream of or within visual learning. Located in extracellular exosome. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in rhesus macaques demonstrated that the LRRN4 transcript was upregulated among common differentially expressed genes in irradiated lungs, identifying it as a potential biomarker for radiation-induced lung injury [Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058]. In humans, a separate investigation of subcutaneous adipose tissue during long-term weight loss found that the LRRN4 gene was upregulated in weight losers over a 12-month period, with its expression pattern being reciprocal to that observed in acquired obesity [Bollepalli et al. DOI:10.1038/ijo.2017.245]. A study in rhesus macaques demonstrated that the LRRN4 was significantly upregulated among common differentially expressed genes in lung tissue following whole-thorax irradiation, identifying it as a potential biomarker for radiation-induced lung injury [Priyanka Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058].