| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCACAGACACCAAGGACAGAGACGCUGGCUAGGCCGCCCUCCCCACU… | 474 nt | 0.5338 |
This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia. [provided by RefSeq, Jul 2008]
A study in human blood plasma demonstrated that the APOA2 was significantly downregulated with age and was used as a protein biomarker for building age-predictive models [Salignon et al. DOI:10.18632/aging.204787].