| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCCGCACAGCAGGUGAGGCUCUCCUGCCCCAUCUCCUUGGGCUGCCC… | 1416 nt | 0.5657 | |
| AGUCGCCUGAACCCCCAGCCUGUGGUUCUCUCCUAGGCCUCAGCCUUUC… | 1474 nt | 0.5590 |
The encoded protein, a member of the tumor necrosis factor family, is a cytokine produced by lymphocytes. The protein is highly inducible, secreted, and forms heterotrimers with lymphotoxin-beta which anchor lymphotoxin-alpha to the cell surface. This protein also mediates a large variety of inflammatory, immunostimulatory, and antiviral responses, is involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. Genetic variations in this gene are associated with susceptibility to leprosy type 4, myocardial infarction, non-Hodgkin's lymphoma, and psoriatic arthritis. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
A scoping review of human twin studies found that the LTA gene, a cytokine involved in inflammatory response, was mentioned in the introduction and discussion as having decreased DNA methylation in cord or child blood associated with birth weight in singleton epigenome-wide association studies [Dany Laure Wadji et al. DOI:10.1371/journal.pone.0315549]. A study in rats demonstrated that blast wave exposure induces a complex vascular wound healing and inflammatory response, with mRNA expression changes in lymphocyte activation and migration pathways being blast intensity- and time-dependent [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].