Basic Information

Symbol
LTBP2
RNA class
mRNA
Alias
Latent Transforming Growth Factor Beta Binding Protein 2 C14orf141 LTBP3 Latent-Transforming Growth Factor Beta-Binding Protein 2 LTBP-2 Chromosome 14 Open Reading Frame 141 MSTP031 GLC3D MSPKA WMS3
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_000428.3
Sequence length
8460.0 nt
GC content
0.5716

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3261.30 kcal/mol
Thermodynamic ensemble
Free energy: -3407.30 kcal/mol
Frequency: 0.0000
Diversity: 2835.73
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((...(((((.(((...)))...)))))((((.(((((((((.(((((.((((((((......)))..(((.(((..(((((....((.((.(((.(((..(((.((((((.....)))).))....)))..)))))).))))))))).)))))).(((((((((...(((..((((...(((((((....)))((((((.((((..((((((.(((((((.((((..((.((((.((.((((((((((((((((((((((.....((((((((((((..((((((.((.(((.((((........)))).))))).))))))....)))).....))))))))......((((((((((((((((.(((.((((((((((((((((((.(((..(((.((((((.((((((.....((((((.(((((.((((((...(((((((.(((((((((((....((.((((((..((((((..(((.((((((....(((((((...)))))))..)))))).(((((((((...)))))))))....))).)))))).))))))))..)))))))..(((......)))(((((((....)))).)))...)))).)))))))...))))))...)))))(((((.(.(((((((.....))))...))).).)).)))....((..((((....))))..))))))))))))))))....)))).))).(((..((((((((((...))))....(((.((..(((((((((((((((((...((.....(((((((....((((((.......((.....)).....))))))...)).)))))))...)))))....))))))))((((((((((((((((....((((.(((..........))).)))).)))))))))..(.(((((....(((...((.(((((((((......))))..))))))))))..))))).))))))))))))..)).)))(((((((((((.(((.((.((((.......)))))).)))....((((....(.((((((((((((.....((((((.(((((((.(((((.(((((.(.(((((.(((.((..(((((.((((..(((((..............(((((((.....(((((((...(((((((((((..(((((..........((((((((((((.((((((((((...((..(((....((((..((((..((.((((((((.((((..((..(((((((...((((((((((.((((((......)))))).))...))).)))))........((((((.......))))))..........((((....))))..(((((((((((.(....((((....((((((..((((............)))).))))))...)))))))))))))))).......(((((((................)))))))...)))))))...))..))))))(((((((((........)))))))))((((..........))))...))))))))...)))).))))))))).))).)))))))(.(((((((((((.((.((.....(((((..(((((..........(..(((((..........)))))..).......))))).))))).)).)).))))))))))).)..((((......)))).......((((((((..((((....((((...))))....(.((.((((((((((.((((.(((((..((........))..))...(((((((((((....(((((...((((....))))..)))))..))))..((((..........)))).)))))))...))).)))).))).))))))))).).))))..)))))))).)).))))).)))))(((((.....))))).)))))))))))))))).)))))))))))))).))))))))).)))).)..))))))))))).)))))..)).....))).))))))).)).))))(((((((..((.((..(((.(((((((((((........(((((((((((((.(((((..((((.....(((.......)))...((((...............))))..((((((.((((..((((((((((((((.((.(((((..(((((((((......((((......)))).....(((((.((((((.(((...((((.(((((((((.(((((.((.(((((((((....(((.((((.((((((((..(((.(..((((((..((((((((.((((((.((((.((((((((.......(((((.....)))))....)))).))))))))))).)))))))...))))..)....)))))).)))))))))))...))))))).))))).)))).)))))))))))))........(((..(((((....(((.((..(((.((........)).))))).))).(((.(...(((((...))).))...).))).))))).))).))).))))..)))))))))..))))).))))))...)))..))))).))((((((((...((((((((....((((....))))....)))).)))))))))))).....)).))))).))..)))))..))))))))))..(((...........)))..(((((((((...(((((.((((...................)))).))))).(((....)))..((((........)))).)))))))))(((((.((((((..((((((.(((.(((((((((((((.....(((.((((.(((((((...((((((....))))))((((.(((((((..............)))))))....)))).....(.((((.((((((((((((((..(((.(.(((.....(((((((((((..(((.((.((((((.(((((.(((.(((((.((...((((.((((((((((.(((((.(((((((((....))))).......(((((((((((.(.((((((((((((((.((.....)).)))))))..(((.....(((((((....))))))))))((((((((...(((.(((.(((.........)))))).))).........(((((......)))))...)))))))).((((.((...)).)))))))))))).))))))))).)))))).))))).((....))..))))))))))..))))))))))).)))...)))))...)))))))).)))..))))........))))).))..))).).))).)))))))))))))))))).)...)))....))))))))..)))......))))))))..))))))))(((((...(((.....))))))))....(((((.((((((........))))))..((.((((((((...(((((((....))))))).)))))))).)).....(((((((((.........((.((..((.(((((((.((((((((.((((....((((((.((.(......))).))))))......((((.....))))..(((((((........))))))).)))))))))))).))))..))).))..)).))......(((((.((....))))))))))).))))).......)))))))))))...)))))).)))))))))))))))))))))))))))....))))).).).)))).)).)..)).)))))))))((((((((....(((........)))(((((((...((..(((((((((..((((((((((.(((.((...))..)))))).)))))))(((((((..(((((((.....))).).)))))))).))..)))))))))..))...)))))))((((((((((((.((.((((.......((((...(.(.(((.(..((((..((((.(((.....))).))).)..))))......).))).).)))))...)))).)))))))).))))))..((...(((....)))..))..)))))).)))))))))))))).)))))((((((((((((((((((...((...((....((((((..........))))))))..))...))))))).)).))))).))))((.(((....))).)).((((((((((((.((((...(.((.(((((....(((((((((((.......))))((((((((.(((........((.(((....))).))((((((.((((..((.(((((((....))))))).))..)))).))))))((((..((((.(((((((((........(((((.((((((((......))))...(((((((((.(((((((.....)))).((((((....)))).))..))))))))))))....(((.....)))..)))))))))..(((((.....))))).)))))).)))))))..)))))))))))))))(((((((...((((..((..(((((...((.((((..((....))..)))).)).)))))..))...))))...))))))))))))))))))).)).)...)))).........))))))))))))))))))))))).)))))).))).((((.((........)).))))...(((((((.........))))))).((((((((......))))).)))))).))))...))))))))......(((.((......)).)))(((((((.....)))).))))))))).))).)))))).........)))))..))))).(((.((((....(((((..((((((..(((((((((((((.....(((....((((.......)))).))))))))).))........)))))...))))))))))).)))))))((..(((....)))..))(((((.(.....((((....))))...).)))))......)))))))))))))).......(((((((((((((((((((((.(......))))))...)))))))))..))))))).....)))))))).)).))))...))...)))).))...((((((.((((((((((((.(((((((((..((((((......(((((.(((...))).)))))..))))))(((((((.((..((((((......(((.(((..(((((((................)))))))..((((...))))))).))).(((((((((((((((((.((((((((((.(((...........))))))))((((....((((((.((((.......(((.((((.(.(.(((((((.....(((((.......))))).....))))...))).).).)))).)))...))))..)))))))))).)))))))))))).....)).))))))))....((((((((((....((((.(((((((.(((.(((.((.((((.((((((.............((((......))))...))))))...)))).(((((((.(.(.((....)).)).)))))))((((.(((.((.(.(((((...(((...)))...))))).).)).)))))))((((((((((((.(...).))).)))))..)))).....)).))).))).))))))..).))))))))))))))(((((((....((((.....))))((((((((.((....((((...(((((..((((((.......)))))))))))...)))).))))))))))..))))))))))))).))...))))))))))))).))).))((((((...)))))).........))))))))))...)))))).((((((((((.((...............((((((((..(((........)))..(((((.....)))))..........(((.....)))..)))))))).)).)))))))...))).....((((..(((........(((((.......((((.((((((....(((((.((((.......)))).))))))).))))..)))).....)))))........)))...))))..)))))))).))).)))).).)))))........................))))...)))).)))))))))))).)))))....))))).)))))).)))((((((.((....)).)))))))))).....((.((((.(((((((((..(((((........(((.((.(.(((.......)))..).)).))).......)))))..((((((((((...(((.((..((........((((((((..(((((..(((((((....))))............(((....)))....((((.(((((((((..(.....)..)))))....(((((....)))))....)))).)))).))).))).))..)).))))))..........((((((((.((((((......((.(..((((((....(((((.........(((.......))).......)))))......)))))).).))))))))..)))))))).)).)).)))..)))))))))).......(((((((....((((((.((((......)))).....))))))......))))))).(((((((((((.((...(((.........(((..((((((.((...((((..((((((((((((((....(((((((.......................)))))))...)))))))).((((...(((((..........(((((((....((((.(((........)))))))))).)))))))))....))))))))))))))....))))))))..)))...........))).))))))).))).)))))))))))))))).))...(((......)))..((((((......))))))..(((((((.....)))))))........((((((((((((..(((..((((((........((((((((.........(((((.(((((((((((....((((((......))))))......((((((((.(((............((((((((...((((........))))....)))).))))......(((.((((..((...........)))))).))).......))).))))))))((((((..(((........)))........((((.........((((((...........))))))))))..............))))))((((((((((..(((((((.(((..............((((((((.(........))))))))).(((((((.........))))))).)))))))))).........))))))))))..))))))))).))..)))))........(((((((...((...))...))).))))....(((((((((.(((.(((.(((((.((.(((((..((((.(((..(((.(((((((((((.(((((((.((((.((((((...(((.((((((..((((((..........((((((..........((((((((((((...((((((...................))))))((((((((.(((((.(((.(((((((((((........((((((((........(((((...(((.(((((....)))))...)))..........(((((................)))))...........)))))............(((((.(((......)))...((.((....)).))............................))))).....(((((((.(((((....)))))))))))).............)))))))).......))))))))))).)))))))).))))))))............))))))))))))...........((..((((..........(((((.((((((((......)))))))).))))).........))))..))))))))))))))..)))))).))))))))).)))).)))))))...))))))))..))).)))..))))))).))))).)).))))).))).))).)))))))))....))))))))...)))))))))))))))))))))((((((((((..((....))..)).))))))))..((((((.(((((((((((...((((.....)))).....)))))))))))))))))))))))).......
Thermodynamic Ensemble Prediction
..(((((((...,((((,((({,{|||{{{|||||{,({{((((((((,,({.(({((,..(((((((((((.,{.((.((((((((((((((((.(((({,.{{((.(({.((((({,.,.,||||{||..||,{}}||,(((((((((({{(,(((((((({(,((({,,,.,,|.|,|.,.}},||{|||||{,{|{{{((((.{({{{..,.||,||{{||{|.||,||{.||,{||,.....|{|{,.||||||||||}}}.}}....{||||{{{{{||,,{(((((.{(.(((.((((........)))).))))}.))))))((((((((...{{{(||,{,((({,((((,,((((,({{,({{{{,}...}||||||||}|,,.,}))|..||||.,.||||||}}.,,,.,{.{{{{{{|{{{{{,.{{{{|..,|{{((({,((((({({({{||.,({.((((({,{((((((..(({.,{||{{.,,|{|{||||,,,))))}}}}}})))||,(((((((((...)))))))),.,}}))),))}}}),))))))}},})}})))),||||..||..||{{{,{{||.,,.)))},|||,||||||,||}||||,,|}|}|||||{|,.{{(((((((.(((((,{{{{{{(((,,,{(((,,.(({{{..,{.|,..,,,|}.{{{(((((({..,||,|{,(({{....}))))}.})....))))))))))))))}}}})}}...,,,(((((...,))))}{{{(({(|{{(...{{{((|(({((.{,({(((({.,,{{.(({....,,{{{,{{,|,,.......,}}}......,,.))}}}}({(({.{{({{.....,}})))))}},,||||||||},|}}|||},|||||||||||{{{({|{,{{{{||,|||,,|||}|.((.(((((((((......))))..))))),)).},,|||}}|||||||,,,,,||||||}}}}},})})}},..},,.,||||}},},,}},},||||||||}},}|||.},.,}))}}}}}}.|||||||{,((((((,({((({(,(((((.(((((,(,{(((,,{((,((,,{{{((.((((,.{{{||,,,.........}}|||||{(,,,,,(({((((,..(((((((((((..,{({,..,((((({..{{...((.((((.((((((.((((.(((,{(((....))..,,))).))).).)))))).))))}},,....))))))..((((((((((.((((((......)))))).))...))).)))))........((((((.......))))))..........((((....)))}..{((((((((((.(.{,,({((....((((({,.{(((,.,....,.,,.)))).))))))..,)))))))))))))))}....,..(({{(((,,{{{{,.........||,,|||(((((.(((....(((((((.(((..(((((.((((.....((.((((....({.{(((((....)),,)))..)})))).)).,.))))...))))).))).).))))))))).)))))|||,,{|,...{|||,.||,{|||||||..,||{..(((((({,.{((({({({{({(.{,,(({.{.{{|.(({(((({{,.,{{(({(((({(({((..,,,,{,|||}|||{.{,((,({(((({,.((({.....|||..,).)),)).}}||.||||{|||||.{{||,|||||,.||}}}},.}.))},)),,.((((((({{{{,,,.(((((...((((....))))..)))))..,)))..((((..........)))).))))))).,.}}}.}))),|}}.}})))}}|||},)}}},.}))})))}.)),}}||||||{{((({((,,...,|||||||}},}}})))))))}.}}}}||||}}||||.|}}},))}),)))),),.}}))}))||||,||}||,,||,,,,.|||,||||}}}.}|,||}|{{{{{||}},|,||,,|,,.||||||||{||,,,,,...((({{(({{{(((,({{{{,,({{{..,,.{,{.,||,..,,)||||.||,,|,.....,,,..)))))))),.{{|||||,}}||||||||,{|||{.||||||{....|{{((|{(.{,,.|{{|{{{.,.|||,..||||||||,.{|||||,|,|.||||||,|,.||||||,||{||,|{.{{{{,||||,..,|||,||||.||{|||{,.}|||}|}}|||||}}}||{{((((.((((({{(((,{((((((((.......(((((.....)))))....)))).))))))))))).)))))))...}}}}..,....|||||{{|||||||||||{{{|,,.|||.|||},.,|||{|}}}},|||||}|,.{,{...{|||.{((((.,({((((((,{(((,{..||..{|{{|{||.|||||}.||,|,,|||||{....||..|||.{{|||{,||||}.,|{((((.,,})}}{(((({,{{{.,,({(({({{|{{,{|{{.,{{{||,,,((((((((...((((((((.,,.((((....))))},..)))).)))))))))))),.,,,||,|||||.|{({{(({|.,||(|{(((({{{(({,.{{{{.....,,,..(((((((((...,((((.{{{(,,.,...{,,........,|||,.,,,,,.}}|}...||,|||||,...}},,})}))}))))))))).{{({.({{({(,{(({(({{{{,,(((({((((((((.....(((.(((|,(((({{,...((((((....)))))|((((.((((((,...,||||.....,|||||||{...}|||,,,,.(.((((.((((((((((((((..(((.,.(((.....(((((((((((..(((.((.((((((.(((((.(((.(((((.((...((((.((((((((((.(((((.(((((((((....))))).......,,{((((((({,(.((((((((({((((,{({{{{{||{|||},||..,.,...|,(((((({....))))))).||(((({(({...,||.|||}||{,...,,.}}))))),.}}}.....,,..,{,||,..}}}))}}}.{{}|||}}},|||||.|}},.}}.,,))))))))),}))))))))).),)))).))))).((....))..))))))))))..))))))))))).)))...)))))...)))))))).)))..))))........))))).))..))).,.))).)))))))))))))))))).},},}))|...)))))))},,))}......)))))))}..})))))}},||,|,,|,||}}},|}))}))}}}}}}{{{(({(,{{(({{{,....,||}}}.}||,((((((({...(((((((....))))))).}))))))).},.,..}||}.,})))))}..,|||||,,,..||}|||((((.((((((((.((((....((((((.((.{......})).))))))...,,,{{{,,,,,.}}},..(((((((........))))))).)))))))))))).))))..}}}.,,..,},}}..|.|{(((((.((....))))))).))|{{(|||,....|,|||||||}}}}...|||||}||||}}|||||}}|||}}}}}}})))),.,.||||}}.).),}))).}}.}..}),))})}))))),,,},)))),}.}}}}))),,||{|{{{|||{|..{{.,(((((({{|..,,,{{||||||||{,||,||||,.|}||,},}}}})})||{{{{{,.|||||||.,.,,))).),,}}))))).}|,,})))))))).,)),}}))))))),}))).,,,|||,||}|||||,|,||||||,..||}|.}|}}||.,||}}}.{||,..,},}.)))).)))))}})}.,,.)},)).)),},))))..},})))).})))))}}})))))}}})).,}}}}|||,(((((..,((...,,,}}))))).,}},))))))))||{{{||||||||||{||}}},|..,||.},}{{{{{{......,,,.)))))),,.,}},,.)))))))}||,|||}}.||}},,{((,...})))}).}))))}},}}},)))))},||}..}),))||}|},||.}}}}}.}))).)))),}}}))}})))},}}},..},|.|||,,|{...,)))))))),})))))))))}}),},,))),).,))}})))))),,}})}))).)))))||}|||}}.,.{((((((.{(({(.((((...((.{((((....,,})))...(((((((((.(((((((.....)))),((((((....)))).))..,))))))))))).}}.)))).)..)))}.)))))))))}.,}))),.,))))))))))))))....)))))))).,.||{{.....)).}}...))))))))))),,,,||}}}.,||{{{,,,,|.|||}}|.|}}}.},,})))}}))).(((.((((....)))))))}|||,|}}},}}||,..,||{{.{.,,{{.||))|||||}))}|}|||,.|(({({{{{{{,||.{(((,((..,,.,{,||{}|||,,.{((((((..{....}.))))))}.((((((((......))))).))),||||.}|||||{|,{{{|,.{{{,({{{{{{.,..,{,{{{{((,{{{,...,}))}),))},||||..,{{.|{{{{,..}}}||||{{{{{..(((((,,,,}}}}}...|((.(((({|,.....{(((....)))),,.{|{((({....((((((((((..{(({{{((((({(,..,,.,.(((((({{{.((((...)))).)}.....,...(((....)))...)))))))......{{{,....})})}}})))))))....,}}}}(((({{...}}.))))..{((((((((((((((((((((.(......})))))...)))))))))..))))))}|{,....)).}},)))))))))}{((.,,{,,{,||,..,||}|||}}}}}}))}}}}}))))),((((((({,....,}}}}}}}.(((({{....}))))),.(((((.((((..(((.....}})))))...))))).|..(((((((................))))))),.(((,.,.|||||||{||,.{{{((((((((((((({{((((((((((.(((..,........))))))))|{{{..,,((((((.((((.......(((.((({.(.(.(((((((.,...(((((.......))))).}...))))...))).).).}))).)))...))))..))))))))),.,))))))))))){{{{{||,|||||||,....((((((((((....((((.({(((((.(((.(((.(({({({.((({{{,,|.,..,{....{{{{......)))),..)))))).,,)))){(((((((.{.(.((....)).}}.)))))))|(((.(((.((.{.(((((.,.(((...)))...))))).}.)).))))))|((({((((((((.(...}.))).)))))..))))...,.)}.))).))).)))))}..).))))))))))))))(((((((....((((.....))))((((((({{((....((((.,.(((((..((((((.......))))))))))).,.)))).))))))))))..))))))),}}||{{||...||,||,.{{{{|{{{((....{,.(((((.(((({.........,......))))}.)))))..))))))))),.)),)).,,.....,{{|(((,..}|},,||}}.}}}}})....(((((|...,))))).}}}))}}..|}|}}}}..({{((..(((((....)))))..)).)))...,...((((((..((.....(((((....,,.((((.((((((....{((((.(((({....}.)))),))})))).))))..)))).,,..)))))))..))))))...}||||}}||||||||,}.,.,))),))))))))}},...,,....,}...,,}})))}})).,))))},}})))))},},.}}})},...}}|||,||||||.|||({(((({{(,,,,||,|||}}}||||{,,..,(|{(((.(((((((((,,((((({....}}}|}||{{{{,,{(.,{{{,{|{{,,,.,{{{||..,.,,,{{{{{(((({{((((,{{{{((,{{{{,{.....,,.,|||{{(((..(((((..(((((((....)))},.....,,,...{{.....,}}.,..((((.(((((((((..{.....}..)))))....(((((....)))))..,|)))).)))).))).))}.}}..}}}}))),}..........||||||||.,||||,......{|}}}}||||,.,,},}}}}}}}}.....,|||||,.|}||,|,,.{{{{{{.{{{{.{{{{{{{{|{{,{{||||{|,.|{{{(((({,,.....,,..,))))))))}.......(((((((,{..((((((.{(((......))}}..,..))))))..},..))))))).....||||{||,||,}}{{,..{{{{.....,.||||{{,,,{,..{(({,{(({,.{((((((((.,,.(((((((.......{...............))))))),..))))))))}||||,.}||{{,.,{({,....||}}},.,,||{(((.(((........)))))))}},,))},}}}}|,,..,)))))},},.})))}}}})))),}}|}}}.,,...,,,,,.}}}.,})))),.)))}}}.))))))))))))).)),..{{{......}}}..((((((......))))))..(((((((.....)))))))........{{{{|||{{{||..,{(|,{({{{{.,,..,,,{({{{{{{....,...,{({{({({{(({{(((((...((((((......)))))).}}}}}{(((((({.{{{,,......,,,.{{{{{(({...{{((.....,..|}}}....})))|})|}....{.(((.((({..((...........)))))).))),}.....))).)))))))},,,,||,,{{{........)))....|{{{,,,,}},,.....((((((...........))))))}}},.........,..,,|||}||((,{{{,,,,..(((((((.(((..............(((((((,,(.,....,}))))))))).{((((((.........))))))}.}}}))))))).........||||}|||||{{,},,,,,,,})))}))))}...,,...,,,..,,..,.,},,)},,,)))))}},....(((((((((.(((.(((.(((((.{{.,,((.{{(,{,.(((..(((.(((,(((((((.(((((((.((((.(((((,..{(((.{(((((..(((((({,........,(((((......,,..((((((((((((..,((((((...................))))))|(((((((.((((,{(((.(((((((((((........((((((((...,,,,.(((((..,({(,(((((,,,.}}}},...},}.....{{{,,(((((................)))))...........,,,..............|||||.{{{......))),,,||,{|,....},,,,,,,,.......................,,,,,.....((((((,{(((((....))))))))))))..,,,,,......)))))))).......))))))))))).)))))))).))))))),............))))))))))))..,,......,{{..{,||,......,,.{{{{{|||(((,,......,}))))))}.|((((.....})))),,}..},}}))))))))))..)))))}.))))))))).)))).)))))))...)))))}}),.))).)))..))),,,,.))))).}).))))).))).))).))))))))}....))))))))...))))))))))))))))))))}{(((((((((..((....))..)).))))))))..{(((((.(((((((((((..,((((.....)))},,...))))))))))))))))}))))))).......

Transcripts

ID Sequence Length GC content
CCAAAAAUAAAACCGUCCGGGUCCCCUUCAGACGGCUGCAGGCACAGGG… 8460 nt 0.5716
Summary

The protein encoded by this gene belongs to the family of latent transforming growth factor (TGF)-beta binding proteins (LTBP), which are extracellular matrix proteins with multi-domain structure. This protein is the largest member of the LTBP family possessing unique regions and with most similarity to the fibrillins. It has thus been suggested that it may have multiple functions: as a member of the TGF-beta latent complex, as a structural component of microfibrils, and a role in cell adhesion. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the LTBP2 was significantly up-regulated in left ventricular myocardium from cases of autopsy-defined arrhythmic sudden cardiac death compared to nonarrhythmic deaths, forming part of a distinct transcriptomic profile associated with active fibrosis and a vulnerable substrate for fatal arrhythmias [Caudal et al. DOI:10.1016/j.jacep.2024.08.013]. In a rat model of pulmonary arterial hypertension-induced right ventricular failure, RNA sequencing identified the LTBP2 as upregulated (4.16-fold) in diseased right ventricle tissue, with its dysregulation conserved across species and linked to fibrotic pathways [Potus et al. DOI:10.3390/ijms19092730].