Basic Information

Symbol
LTBR
RNA class
mRNA
Alias
Lymphotoxin Beta Receptor TNFRSF3 TNFCR TNF-R-III TNFR2-RP TNFR-RP D12S370 Tumor Necrosis Factor Receptor Superfamily Member 3 Tumor Necrosis Factor Receptor 2-Related Protein Tumor Necrosis Factor Receptor Type III Tumor Necrosis Factor C Receptor TNFR3 Lymphotoxin Beta Receptor (TNFR Superfamily, Member 3) TNFR Superfamily, Member 3 Lymphotoxin-Beta Receptor Lymphotoxin B Receptor LT-BETA-R TNF-RIII TNFR-III
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002342.3
Sequence length
2134.0 nt
GC content
0.6157

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-870.20 kcal/mol
Thermodynamic ensemble
Free energy: -911.12 kcal/mol
Frequency: 0.0000
Diversity: 500.77
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((.(((((.((((((.((((..(((((((.(((((((((((((((..((((((((((((((((.(((....(((((.(((((........))))).))))).(((((((.(......).)))))))..(((((.((((((..............))))))..)))))...((((....))))((((((((.....((....))....))))).))))))))))))...)))).))))))..)))).)))))))))))..))))))))))).(((((((........)))))))((((.........))))..((.(.((((((((((((((....((.....))......((((((....(((((...((((..(((....(((((((.........((((..(((.((((((((....(((.(((((...(((.((((.((((((.............)).))))(((..........))).........)))).)))..))))).)))((((.((.(((((((((.....((((.(.(((((((((..(((..(...((((...)))).)..)))....)))).))))).)...))))))))))).)).))))))))).))))))))))))......))))))).....))).))))....)))))..))))))...(((....))).))).)).)))))).)))).))....((((...(((((((((..((((((.(((((((((..(((((.(((.(((......)))..))).))).)).))))))....((((((((((((((.......((((((...(((((.((((.((..((((((((..((.((((((........))))))))..((.((((.(((((..(((..((((((..((((((.(((.(((((((((((((((...(((((.......)))))...)))))))...(((((.((((........))))))).))(((((.(((.............(..((.(((((((((.(((((..(((((........((((..((..(((...(((....)))..)))..)).))))..(((((((((((....((((((((((((...((((((....))).)))..((((....((((.((.(..(((.((((......)))))))..))).))))..)))))))))))...(((((..(((((.((((....(((.....)))...))))..)))))...........)))))..........((((...))))))))))))))))))))....))))).)))))..))))))))).))..)............))).))))).....((((......(((((....))))).......)))).....))))))))...))).(((((((..((((.(......).)))))))))))...........))))))..)))))))))..........((.((((.....))))))......))))).)))).))(((((...(((((.((((......)))).))))))))))..(((.....)))..((((((.....))))))))))..)))).)).)))).)))))....((((((....)))))).)))))).......))))))))..)))))).(((...)))..(((((((((((((.((....((((((((.....(((((.((((.........)))).)))))..))))))))...(((..((((((((((..((....((((((......)))).))....(((.....)))....(((((.(((.....(((..(........)..)))....))))))))....))..)))).)))))).)))....(((((((((...)))))))))(((((.......))))))).))))))......(((....)))......)))))))(((.(.((((.((((.((((...)))).)))).))))).)))...........))).)))))).))))......)))))..)))))))))).))))))))))......(((..((...(((((.(((((......))))))))))....))..).))..
Thermodynamic Ensemble Prediction
..(((((.(((....{({{{(((,.{(((((((.(((((((((((((((,,({{{{|||||{{((((.(((....(((((.(((((,...,,,,|}}}),))))}.(((((((.(......}.))))))),||||{|,|||||,,,||},.,}},,{{|||{||{{|,||,.,|(((({...|||,((((((((.,.,.((....))...})))))},)),)))}}))),,.)))},)))))),.}})).)))))))))))..)))))))|||}.(((((((........))))))){{||,...,.,,,))))..((.(.((((((((((((((....,{.....}}......((((((....(((((...((((..(((....(((((((......{{.{(((..,({.((((((((....(((.(((((...(((.((((.((((((,,.....,.....}}.}}}},||..............,.,,}},.)))).)))..))))).))){(((.((.(((((((((.....((((...(({,,{(({..((({{.,{{(,({{{.,,,}...})})}}..),))})))))})}..))))))))))).)).))))))))).))))),)}))))}.,...))))))).....))).))))....)))))..))))))...({{....})).))).)))))))))},))),)){((((((((.......((((((((,,,,....((((((..(((((.(((.(((......)))..))).))).)).))))))....((((((((((((((.{...{.((((((...(((((.((((.((..((((((((..,,.,(((((........)))))}}|(((.((...)).))),....((((((((((((((((((((,..,((((((((((((...(((((.,.....)))))...))))))}..{(((((.((((........))))))).))|(({(,(((......,{{.......||,(((((((((.(((({..(((((........,(((,.((..((({{{((,..}}),)},)})..)).))})..(((((((((((,...((((((((((((...((((((....))).)))..((((..,.((((.((.(.,(((.((((......))))))).,))).))))}.)))))))))))...(((((,,(((((.((((..,.,(({,...}})}}.))))..))))).........,.)))))....,.....{,,....)))}))))))))))))))))....))))).)))))..))))))))).||..,............}}}.}}}},...,.|||||.....(((((....))))},......)))}..,.})))))))))))))..(((((((.,({({.,......).)))})))))))..((((.....})))},,...}}...............({.((((.....)))))).,....)))))))))))),((((,..{(((((.((((......)))).)))))))))).,(((,...,)))..((((((.....))))))))))..)))).)).)))).)))))....((((((....)))))).)))))).,...,.)))))))}.,)))))).{{(,.,{(((((((((((.((((({,{....{(({,,(({....|||,,.(((({{{{{{{{{{{||{||,,,.})))}}}|}...(({..((((((((((..((...,{{((((.....,)))}.||{|..{{{..,,.}))}...(((((.(((.....(({,{(.,......)},)))...,))))))))....))..)))),}))))).}}},,..(((((((.{{{{{,,,,))))|((((.......))))}))))))).,.{{{{{{{(....}}}......)))))||{{,.{{((((.((((.((((...)))).)))).,)))),))}........,,,)))))})))))})).,},})))))))))))},)))))))))).))))))))...))).)))))}.{((((.(((((......)))))))))}..))))))))....

Transcripts

ID Sequence Length GC content
ACUCCCACUUCCUGAGCUCCGCCAUGGGAGCCCUGGAGGCCCGGCCUGG… 1905 nt 0.6147
ACUCCCACUUCCUGAGCUCCGCCAUGGGAGCCCUGGAGGCCCGGCCUGG… 2134 nt 0.6157
Showing 11 to 12 of 12 entries
Summary

This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]

Forensic Context

In human corpus cavernosum tissue, single-cell RNA sequencing identified the LTBR as a gene marker highly expressed in the EC2 endothelial cell subcluster [Zhao et al. DOI:10.1038/s41467-022-31950-9]. A study in mice demonstrated that specific in vivo α-particle irradiation of Kupffer cells in the liver induced a distinct gene expression profile, characterized by the up-regulation of the LTBR (Lymphotoxin B receptor) alongside other genes such as Hist1h1b and Phf14, as identified through oligonucleotide microarray and validated by real-time PCR [Roudkenar et al. DOI:10.1269/jrr.07078]. This specific up-regulation pattern, observed 20 hours post-irradiation, provides a molecular signature differentiating Kupffer cell-targeted exposure from endothelial cell-targeted or γ-ray exposures in this experimental model.