| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCCCACUUCCUGAGCUCCGCCAUGGGAGCCCUGGAGGCCCGGCCUGG… | 1905 nt | 0.6147 | |
| ACUCCCACUUCCUGAGCUCCGCCAUGGGAGCCCUGGAGGCCCGGCCUGG… | 2134 nt | 0.6157 |
This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
In human corpus cavernosum tissue, single-cell RNA sequencing identified the LTBR as a gene marker highly expressed in the EC2 endothelial cell subcluster [Zhao et al. DOI:10.1038/s41467-022-31950-9]. A study in mice demonstrated that specific in vivo α-particle irradiation of Kupffer cells in the liver induced a distinct gene expression profile, characterized by the up-regulation of the LTBR (Lymphotoxin B receptor) alongside other genes such as Hist1h1b and Phf14, as identified through oligonucleotide microarray and validated by real-time PCR [Roudkenar et al. DOI:10.1269/jrr.07078]. This specific up-regulation pattern, observed 20 hours post-irradiation, provides a molecular signature differentiating Kupffer cell-targeted exposure from endothelial cell-targeted or γ-ray exposures in this experimental model.