| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCUAGCACUCUGACCUAGCAGUCAACAUGAAGGCUCUCAUUGUUCUG… | 1490 nt | 0.4134 |
This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis. [provided by RefSeq, Oct 2014]
A study in humans demonstrated that the LYZ is a differentially expressed mRNA marker for monocyte identification [Liu et al. DOI:10.1371/journal.pone.0318151]. In a separate investigation of human and mouse skin wound healing, the LYZ was identified as a lysozyme marker expressed in myeloid cell clusters [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in mice demonstrated that the LYZ transcript, characterizing phagocytic cells, was significantly upregulated in the ipsilateral neocortex and hippocampus three days post-injury in a closed head weight-drop model, representing one of the largest expression differences observed [Israelsson et al. DOI:10.1089/neu.2008.0676].