Basic Information

Symbol
LYZ
RNA class
mRNA
Alias
Lysozyme 1,4-Beta-N-Acetylmuramidase C EC 3.2.1.17 Lysozyme C LZM Lysozyme (Renal Amyloidosis) Renal Amyloidosis C-Type Lysozyme Lysozyme F1 AMYLD5 LYZF1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_000239.3
Sequence length
1490.0 nt
GC content
0.4134

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-420.90 kcal/mol
Thermodynamic ensemble
Free energy: -450.55 kcal/mol
Frequency: 0.0000
Diversity: 288.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........(((((((((((((.......((((((((.((......)))))))).)).......)))))).))).))))(((((((((((((..((((((((((......)))((.(((((((..(((((((((..(.(((.(((((.........((((((((((.(((((.(((.....(((((((((((.......(((((((((((...........((.((.((((.((((((....(((((((...(((..((.((((.(((.((((.((..((....))..)).)))).))).)))).)).))).....))))))))))))))))))).))......((((...)))).)))))))))))..(((((((.((((.(((...)))..))))...(((((((..((((..(((...(((.((((....)))).))).))))))).)))))))((((((.((((((...)))))).)))))))))))))......(((((..((((((.......))))))..)))))...((((....))))...)))))..)))))).....((((....((((((((..(((((.(((.((........))))).))))).))))))))..))))...((((((((.....)))))))).)))...)))))..))))))))))......((((((....(((((....))))).......))))))..........))))).))))..)))))))))..)))))))))(((((.......)))))(((((((.((((((((((((((.........)).)))))))..))))))))...))))))))))).(((..(((((((((..(((((......)))))...(((((((..((...((((((..(((((............)))))...((((.(((...))).))))...(((((.(((....))))))))....((((((((...(((...((....))...)))...)))))))))))))).))....)))))))....((((((((((((....))))).................))))))).........(((((((((..((((................((((((...............((.........(((.(((((((((((...))))))))))).))).........)).............))))))))))..)))))))))..((.(((((....(((((((((..........((.(((((((.(((.......(((((((.......)))))))))).))))))).)).......)))))))))))))).))..(((((((.((((...))))))))))))))))))))..))).......(((((......((((((((((..((((....))))))))).)..))))......)))))...........)))))))))))))......
Thermodynamic Ensemble Prediction
..........{((((((((((((.......{{(((({({((......)))))))).}}.......)))))).)))},)))(((((((((((((..(((((((({(,,,..,|}|{{,(((((((..(((((((((..(.(((.(((((......,,.((((((((((.(((((.(((.....(((((((((((.......(((((((((((...........((.((.(((((((((((....{((((((...(((..((.((((.(({.((((.((..((....))..)).)))).})).)))).)).))).....))))))))))))))))))).)).,,,..,{|{{{.,,,)})))))))))))..{((((((.({((,(((..,||}..}}}}...((((({,..{{{{,,(((.{.{((.((((....)))).))).))))))).)))))))((((((.((((((...)))))).))))))))))))}....,.(((((..((((((.......))))))..)))}}..,(((|....,,,).,,)))))..}))))).....,{{,....((((((((..(((((.(((.((........))))).))))).))))))))..}}}}...((((((((.....)))))))).)))...)))))..))))))))))....,,{(((({....(((((....))))).......}))))}..........))))).))))..)))))))))..))))))}},(((((.......)))))(((({((.((((((((((((((.{.......)).)))))))..)))))})}...))))))))))).,{(..(((((((((..(((({.....,})))}...(((((((..{{...((((((,,(((((............))))).,.((((.(((...))).)))).{{((((,,(((...{|||.|,,}....,{{||||{..,|||,}.||}.,,||,..}}}.,})))}}}),)))))).)}....)))))))....{{{{{{,(((((....))))).......,|,.....||}))}}}),,.......(((((((((..((((................((({{{|{,.....,,,.,,.((.......,.{((.(((((((((((...))))))))))).))}.........,,.............,,}}}}))))..)))))))))..,{.,{{{,....(((((((((..........((.(((((((.(((....,,,((((({{..,,.,.)))}}}}))).))))))).))....,,.))))))))),}}}}.}}..{((((({,((({...))))))))))))))))))))..))}.,....{(((.{......}.}}}}.,,...((((....)))).}}},.,.,,{.{(({.....})),..}}}.,...)))))))))))))......

Transcripts

ID Sequence Length GC content
AGCCUAGCACUCUGACCUAGCAGUCAACAUGAAGGCUCUCAUUGUUCUG… 1490 nt 0.4134
Summary

This gene encodes human lysozyme, whose natural substrate is the bacterial cell wall peptidoglycan (cleaving the beta[1-4]glycosidic linkages between N-acetylmuramic acid and N-acetylglucosamine). Lysozyme is one of the antimicrobial agents found in human milk, and is also present in spleen, lung, kidney, white blood cells, plasma, saliva, and tears. The protein has antibacterial activity against a number of bacterial species. Missense mutations in this gene have been identified in heritable renal amyloidosis. [provided by RefSeq, Oct 2014]

Forensic Context

A study in humans demonstrated that the LYZ is a differentially expressed mRNA marker for monocyte identification [Liu et al. DOI:10.1371/journal.pone.0318151]. In a separate investigation of human and mouse skin wound healing, the LYZ was identified as a lysozyme marker expressed in myeloid cell clusters [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in mice demonstrated that the LYZ transcript, characterizing phagocytic cells, was significantly upregulated in the ipsilateral neocortex and hippocampus three days post-injury in a closed head weight-drop model, representing one of the largest expression differences observed [Israelsson et al. DOI:10.1089/neu.2008.0676].