Basic Information

Symbol
APOC2
RNA class
mRNA
Alias
Apolipoprotein C2 Apolipoprotein C-II APO-CII APOC-II Apo-CII ApoC-II APC2
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_000483.5
Sequence length
660.0 nt
GC content
0.5091

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-205.90 kcal/mol
Thermodynamic ensemble
Free energy: -218.14 kcal/mol
Frequency: 0.0000
Diversity: 124.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((.....(((((.((((.....(((.....((....))....)))..)))))))))....))))))))((((..((((((...((((....((((.(......))))).((((((.(((((.(((.(((.(............).)))..))).)))))......((((((((((.((((((.(((((((.(..(((....(((.(.....))))...)))..))))))...((((...))))((((((((..(((.((((((...)).(((.((.(......).)))))..)))).)))..))))))))..)).))))))((((...(((((..((((..((((....(((((.(((..((((((...))))))..))).)))))......))))..).))).)))))))))))))))))))))))))..)))).))))))..))))..((((((.((((......))))...)))))).((((((............((((((((((((.((((((((.(((......(((..((((((...))))))..))).........((((.(((((.....))).)).))))...))).))))))).).)))..)))))))))...))))))........)))..........
Thermodynamic Ensemble Prediction
{({((((((((...{,(((((.((((.....(((.....{(....}}.,..)))..)))))))))}...})))))))((((..((((((...((((....((((.{......})))).((((({.((((,.{,,.||,.,...,{{{{{{{...,))},})),)}})),,...{((((((((((.((((((.(((((({.(..(((....(((.{.....})))...)))..}))))}...{(((...)))|((((((((..(((.{(((({...}}.(((.{(.{......,.}})))..}))}.)))..)))))))),.)).)))))){(((...(((((..((({..((((....(((((.(((..((((((...))))))..))).)))))......))))..).))).)))))))))))))))))))))))))..)))).))))))..))))..((((({.,,{|......,,}}...}))))}.((((((.,....,,,...((((((((((((.((((((((.(((....{.(((..((((((...))))))..))).,.......((((.(((((.....))).)).))))...))).))))))).).))),.,))))))))...})))))........,,,.......,..

Transcripts

ID Sequence Length GC content
GGUGAGGACAGCCUGCCAGAGUCUGGUCUCUGGACACUAUGGGCACACG… 660 nt 0.5091
Summary

This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene. [provided by RefSeq, Mar 2011]

Forensic Context

A study in human blood plasma demonstrated that the APOC2 was significantly downregulated with age and was used as part of a proteomic dataset to build age-predictive models [Salignon et al. DOI:10.18632/aging.204787]. The protein-based model, which included this biomarker, achieved an R² of 0.59 ± 0.02, and combining proteomic data with miRNA data improved prediction accuracy to an R² of 0.70 ± 0.01.