| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGUGAGGACAGCCUGCCAGAGUCUGGUCUCUGGACACUAUGGGCACACG… | 660 nt | 0.5091 |
This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene. [provided by RefSeq, Mar 2011]
A study in human blood plasma demonstrated that the APOC2 was significantly downregulated with age and was used as part of a proteomic dataset to build age-predictive models [Salignon et al. DOI:10.18632/aging.204787]. The protein-based model, which included this biomarker, achieved an R² of 0.59 ± 0.02, and combining proteomic data with miRNA data improved prediction accuracy to an R² of 0.70 ± 0.01.