| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUGCUCAGUUCAUCCCUAGAGGCAGCUGCUCCAGGAACAGAGGUGCCAU… | 535 nt | 0.5907 |
This gene encodes a protein component of triglyceride (TG)-rich lipoproteins (TRLs) including very low density lipoproteins (VLDL), high density lipoproteins (HDL) and chylomicrons. The encoded protein plays a role in role in the metabolism of these TRLs through multiple modes. This protein has been shown to promote the secretion of VLDL1, inhibit lipoprotein lipase enzyme activity, and delay catabolism of TRL remnants. Mutations in this gene are associated with low plasma triglyceride levels and reduced risk of ischemic cardiovascular disease, and hyperalphalipoproteinemia, which is characterized by elevated levels of high density lipoprotein (HDL) and HDL cholesterol in human patients. This gene and other related genes comprise an apolipoprotein gene cluster on chromosome 11. [provided by RefSeq, Sep 2017]
No relevant information is available at the moment.