Basic Information

Symbol
MANF
RNA class
mRNA
Alias
Mesencephalic Astrocyte Derived Neurotrophic Factor ARP Mesencephalic Astrocyte-Derived Neurotrophic Factor ARMET Arginine-Rich, Mutated In Early Stage Tumors Arginine-Rich Protein Protein ARMET DDDS
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_006010.6
Sequence length
909.0 nt
GC content
0.4972

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-291.20 kcal/mol
Thermodynamic ensemble
Free energy: -310.13 kcal/mol
Frequency: 0.0000
Diversity: 236.87
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........(((.(((((((((((((((.(((((..(..(((((((..((((((((((((....(((((..(((((.(.(((((.((((((((((((((..((.....))..)).)))).)))))))).))))).)..)))))..)))))..))))))))((((..........))))..))))...((((....)))).)))))))..)..))............((((((...))))))....(((((((.((.((((..((.......)).)))).))...((.((((((((..((((((((.................(((((......))))).(((((((((..((((((((.((..(((((((.....(((((((.......(((........)))...))))))).......)))))))...))...))))).)))..))......((((.(((((.((((((.....)).))))...))))).))))...(((...((((((((((((((..(((..(((((((((((.........((.((((.(((((.............)))))..)))).))))))......))))))).))).....))))).........(((((.((...((((...)))).)).)))))...))))))))).)))..............)))))))..........))))))))..))))..)))).)))))))))......(((((......))))).((((....))))..)))))))).)))))))))).)))....(((((((((.........(((((((((((((........))))))).))))))((((....))))....................((((((...)))))).)))).)))))
Thermodynamic Ensemble Prediction
....{{...(((.(((((((((((((((.(((((..(..(((((((..(((({(((((({,((({((((..(((((.{,(((((.((((((((((((((,.((,...,)),,)}.))))}}})))))).))))),)..)))))..))))}))))))))}}((((..........))))..))))...((((....)))).)))))))..)..))............((((((...))))))...{(((((((.,,,((({..{,,..,|,,||,|||}.},...{{.(((((({{,,(((({{{{........,,,,,,...(((((......))))),|||||{(((..((((((((.,{..(((((((..,,,((((({{.....,,{{{.,,.....}}),.,)))}}}}....,..)))))))...,,...))))).)))..}}......((((.(((({.((((((.....)).))))...})))).))))..,,,.(((((((((((({((({..,{{||{,({{{{,,{|,..,.,...,,.{(((.(((((.............)))))..)))}}))}}}}}}},,,)}}}})),})}...,,)))}},||,.,,,.{((((,..,,.((((...)))).)).}))))...}}}}))},||}}}|..........,,,)))))))..........})))}))),.))))..)))).}}))))))),}....(((((......))))).((((....))))..))))))))))))))))))).))).,,,{((((((((.........(((((((((((((........)))))))})))}}}({{{....)))).......,,,.,..,,....{(((((...)))))),)))).)))),

Transcripts

ID Sequence Length GC content
AGUCGGUCGGCGGCGGCAGCGGAGGAGGAGGAGGAGGAGGAGGAUGAGG… 909 nt 0.4972
Summary

The protein encoded by this gene is localized in the endoplasmic reticulum (ER) and golgi, and is also secreted. Reducing expression of this gene increases susceptibility to ER stress-induced death and results in cell proliferation. Activity of this protein is important in promoting the survival of dopaminergic neurons. The presence of polymorphisms in the N-terminal arginine-rich region, including a specific mutation that changes an ATG start codon to AGG, have been reported in a variety of solid tumors; however, these polymorphisms were later shown to exist in normal tissues and are thus no longer thought to be tumor-related. [provided by RefSeq, Apr 2014]

Forensic Context

A study in Sarcophaga dux demonstrated that the MANF (ARP) is a differentially expressed gene with expression patterns showing an opposite tendency to the A-alpha gene during puparial development, and its expression levels were significantly influenced by both pupal age and temperature (two-way ANOVA, P < 0.001) [Zhang et al. DOI:10.1016/j.jtherbio.2020.102735]. Nonlinear regression models established a relationship between its expression and pupal age/accumulated degree hours, confirming its potential for precise age estimation of pupae to improve minimum postmortem interval estimation. A study in mice demonstrated that the MANF is expressed higher in monocyte-derived macrophages compared to microglia after spinal cord injury [Stewart et al. DOI:10.1186/s12974-021-02161-8].