| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCGGUCGGCGGCGGCAGCGGAGGAGGAGGAGGAGGAGGAGGAUGAGG… | 909 nt | 0.4972 |
The protein encoded by this gene is localized in the endoplasmic reticulum (ER) and golgi, and is also secreted. Reducing expression of this gene increases susceptibility to ER stress-induced death and results in cell proliferation. Activity of this protein is important in promoting the survival of dopaminergic neurons. The presence of polymorphisms in the N-terminal arginine-rich region, including a specific mutation that changes an ATG start codon to AGG, have been reported in a variety of solid tumors; however, these polymorphisms were later shown to exist in normal tissues and are thus no longer thought to be tumor-related. [provided by RefSeq, Apr 2014]
A study in Sarcophaga dux demonstrated that the MANF (ARP) is a differentially expressed gene with expression patterns showing an opposite tendency to the A-alpha gene during puparial development, and its expression levels were significantly influenced by both pupal age and temperature (two-way ANOVA, P < 0.001) [Zhang et al. DOI:10.1016/j.jtherbio.2020.102735]. Nonlinear regression models established a relationship between its expression and pupal age/accumulated degree hours, confirming its potential for precise age estimation of pupae to improve minimum postmortem interval estimation. A study in mice demonstrated that the MANF is expressed higher in monocyte-derived macrophages compared to microglia after spinal cord injury [Stewart et al. DOI:10.1186/s12974-021-02161-8].