| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGCGAGUUACCUCCCGCAGCCGCAGCCGCCGUGCUCAGCGCGAGCCCC… | 964 nt | 0.6566 | |
| AACUGAAGUUCAGCCACCUGCCACUCCUGACUGCAUGGAAGCCAGGUGC… | 971 nt | 0.6056 |
MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. The protein encoded by this gene is one of the light chain subunits and can associate with either MAP1A or MAP1B. Two transcript variants encoding different isoforms have been found for this gene. The expression of variant 1 is suppressed in many tumor cell lines, suggesting that may be involved in carcinogenesis. [provided by RefSeq, Feb 2012]
A study in human trauma patients using RNA sequencing and Western blot analysis demonstrated that the MAP1LC3A protein, an autophagy marker, increases in fibroblasts during scar formation [Wu et al. DOI:10.21037/atm-22-2033]. In traumatic brain injury research, an increase in the MAP1LC3A was detected in neurons and astrocytes post-injury as part of autophagosomal formation, based on findings from studies in species including human, rat, mouse, and non-human primate [Hernandez-Ontiveros et al. DOI:10.3389/fneur.2013.00030]. A study in human HT-29 colorectal adenocarcinoma cells demonstrated that exposure to arsenic trioxide increased the levels of the MAP1LC3A as shown by immunoblotting, indicating its role as an autophagy marker in cellular stress responses to heavy metal toxicity [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774].