Basic Information

Symbol
MAP1LC3A
RNA class
mRNA
Alias
Microtubule Associated Protein 1 Light Chain 3 Alpha MAP1BLC3 MAP1ALC3 ATG8E LC3A LC3 Microtubule-Associated Protein 1 Light Chain 3 Alpha Microtubule-Associated Proteins 1A/1B Light Chain 3A Autophagy-Related Ubiquitin-Like Modifier LC3 A MAP1 Light Chain 3-Like Protein 1 MAP1A/MAP1B Light Chain 3 A MAP1A/MAP1B LC3 A Microtubule-Associated Proteins 1A/1B Light Chain 3 Autophagy-Related Protein LC3 A MAP1A/1B Light Chain 3 A
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_032514.4
Sequence length
964.0 nt
GC content
0.6566

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-403.10 kcal/mol
Thermodynamic ensemble
Free energy: -419.44 kcal/mol
Frequency: 0.0000
Diversity: 292.74
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((....)))......((((.(((..(((((((((.((..........)).).)))))))).))))))).)))).(((((....(((((((((((..(((.((((((.....(((((..(((((((((((((....))))..)))))..(((........)))(((((..((((((((((.......))).))))))).(((.(((...((((.((((((.((((((((...........((((((((((((((.((((....((((.((......))))))((((.((....((((((....))))))))))))((((....))))))))..)))))...))))).))))((((((((((.((((...((((.(((((.......)))))))).)...))))...))).)))).)))((((((.(((((((((((...(((.(......)))).....((((.(((((((((......(((....)))....)))))....((((.(((.(((((((.(((....((((..(((((((...(((((....))))))))))))..)))).....))).)))))))..)))))))))))))))..)))))))))))))))))(((....)))........(((((((...((((((...(((.(((.(((.((......)).))).)))..)))...)))))).)))))))))))))))..((((((.((((((.(((((((.((.((((.((((((....))))).).))))...........(((((....))))).)).))))))).)))).))))))))...(((...)))...)))..))).))))..)))))))))))...))))...))))).(((.....)))......))))).).)))..))))))))..)))...))))).............((.((((....))))))
Thermodynamic Ensemble Prediction
((({({(....}})|,{{..((((.(((..(((((((((.((,.........)).}})))))))).))))))).)),,.{||||,...{,,((((((((..(((,{(((((.....(((((,.((({(((((((((....))))..))))}..|||,,,,{,,,|||((({{..((((((((((.......))).))))))).,((,(((...(({{.{{{||(,((((({{{,..},......((((((((((((((.((((....((((.((......))))))((((.(({,,,((({,,..,,))})))),))))((((....))))))))..)))))...))))).)))).,..((((((.{.((.....}},)))))){((,{(((((((.(({.(((({{...)).))))..,.((((((.((.....)).)))))),))).)))))))),)}}..(((({.,...}||}}....,|}}}...}}||||,{{{|..|},,,||||}|}|}|||,,.,,{,|||||||,|((({{(({,{(((((.{{,|}}||||}|||},,||||((,,(((({..||{|....})))))))),|}}}}.,.|,|}|||||}||||||{{..,.)))},}}}}.|{((((((.,.((((((...{((.({({(({.(({.....)),))),,)),.)})...)))))),))))))))})))}))|.((((((.{(((((.(((((((.(({{(({.{(((((....))))).).)))}...........{((((....))))).)).))))))).))))}}})))))).}.|||...))),,.})),,)}}.)})),,)))))))}}}).,,)))),,,))))),|.|}}....)),.....))))).).)))..))))))))..,}}...}|}}|,,,........,,||.{{((....))))),

Transcripts

ID Sequence Length GC content
GGGCGAGUUACCUCCCGCAGCCGCAGCCGCCGUGCUCAGCGCGAGCCCC… 964 nt 0.6566
AACUGAAGUUCAGCCACCUGCCACUCCUGACUGCAUGGAAGCCAGGUGC… 971 nt 0.6056
Summary

MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. The protein encoded by this gene is one of the light chain subunits and can associate with either MAP1A or MAP1B. Two transcript variants encoding different isoforms have been found for this gene. The expression of variant 1 is suppressed in many tumor cell lines, suggesting that may be involved in carcinogenesis. [provided by RefSeq, Feb 2012]

Forensic Context

A study in human trauma patients using RNA sequencing and Western blot analysis demonstrated that the MAP1LC3A protein, an autophagy marker, increases in fibroblasts during scar formation [Wu et al. DOI:10.21037/atm-22-2033]. In traumatic brain injury research, an increase in the MAP1LC3A was detected in neurons and astrocytes post-injury as part of autophagosomal formation, based on findings from studies in species including human, rat, mouse, and non-human primate [Hernandez-Ontiveros et al. DOI:10.3389/fneur.2013.00030]. A study in human HT-29 colorectal adenocarcinoma cells demonstrated that exposure to arsenic trioxide increased the levels of the MAP1LC3A as shown by immunoblotting, indicating its role as an autophagy marker in cellular stress responses to heavy metal toxicity [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774].