Basic Information

Symbol
MAP1LC3B
RNA class
mRNA
Alias
Microtubule Associated Protein 1 Light Chain 3 Beta ATG8F Microtubule-Associated Proteins 1A/1B Light Chain 3B Microtubule-Associated Protein 1 Light Chain 3 Beta Autophagy-Related Ubiquitin-Like Modifier LC3 B MAP1 Light Chain 3-Like Protein 2 MAP1A/MAP1B Light Chain 3 B MAP1A/MAP1B LC3 B Autophagy-Related Protein LC3 B MAP1A/1BLC3 MAP1LC3B-A MAP1ALC3 LC3B
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Drug abuse diagnoses

MANE select

Transcript ID
NM_022818.5
Sequence length
2147.0 nt
GC content
0.4238

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-557.60 kcal/mol
Thermodynamic ensemble
Free energy: -605.30 kcal/mol
Frequency: 0.0000
Diversity: 578.49
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((.((.((.((.((.((((.(((.(((((......)))))......))).))..)).)).)).)).))...))))).(((((..((..((.((((((((((((((.((((....(((.((((..((.....)).)))).))).(((.....))).((((.((.((..(((.......((............)).......)))..)).)).)))).(((..(((((....((((.((((((...((((((((((((.....((.((..(.(((((((.(.....(((((((......(((.....)))......)))))))...).))))))).)..)).)))))))))))).))(((.(((((.........)))))..)))((((((((((..(((......)))((((.((((((((.((..((((.(((....)))))))(((.....)))...................((((.(((...))).))))......((((...)))).........(((((.....((((((......)))))))))))...)).))))))))..))))..((((((....((.(((((.((((....((.((((((.....)))))).))...))))))))).)).))))))...((((((.(((..............(((((((.((..(((((((.((((((...)))))).)))))))..)).)))))))))))))))).((.((((((.(((......))))))))).))...))))))))))...))))))))))...))))))))......((((((....((((((((.....))).)))))...((((.....))))....))))))((((((((((...))))))))))(((((((..((((.....)))).))))))).((((.((((((...))))))....((.....))...(((((.......)))))......))))......(((((((........)))))))..........)))))))))))).((((..(((((((((((((.(((.((((((..(.((((...)))))..))).)))..))).)))))............(((((((((((((((((((.........(((((((((((.(((.........))).)))))))))))...(((((((((((.(((((......)))))...)))))))....))))((((....(((.((((...(((((((......)))))))..)))).)))...)))).((((..(((.(((((..((........))....(((((..........))))).....)))))..)))..))))((((...))))(((((...))))).....)))))))...)))).....))))))))....(((((((..(((((......)))))...))))))).....)))))))))))).............)))))).))..)).))))).....((((((.......))))))..(((((((.....)))))))...........(((((((.(((.(((((....))))).))))).)))))...)))).((((.....(.((((((((((((((..((((....))))......(((((((..(((((((..(((((((((................(((((((.(((((((((.((.((.(....).))..)).))))........))))))))))))(((((((.....)))))))....((((....((((((.......))))))..))))...))))))).....)).)))))))....)))))))..((((((((((((.((..(((.....)))..))((((((...(((((((((((((..(((((((((((.(((.(((...))).))).)))..))))))))...........((((((..((......))...))))))......))).)))))))).))...))))))..........))))).).))))))......)))))))))))))).)..((((((((((((..((.((((((...)))))).)).)))...)))))))))))))...............
Thermodynamic Ensemble Prediction
.,((((((((..((.((.((.,,.||.|}.||.(((((......)))))......|||.|,.|}|.||,||,||.|}.,,{.,,,}}|,....,||.|{|||,|,.,,,,,,,..||.}}}..}}..((((..{(.....}}.))))..)))))))}|((((({((((((,,,,..(((........)))},,....((((.(((((((((((((.{((((....}})}}(((((....(({((((((((..,((((((((((((.....((.((..{.(((((((.{.....(((((((.,,...(((.....)))....,,)))))))...}.))))))).)..)).)))))))))))).)}(((.(((((.........)))))..)))(((((((((({.{{{,.....|}}((((.((((((((.{{.,(({{.{||,...}}}}|||,{{..,,,||,{{......,..........((((.(({...})).))))......((((...}))).........(((((.....((((((......)))))))))))...}}.))))))))..))))..((((((.,{,,(.(((((.((((....((.((((((.....)))))).))...))))))))).})}))))))...{{{{{{{((,,.(({{{{{....|||||||{.{{..(((((((.((((({...}))))).)))))))..}}.}},}}|}},,}))))}}||.(((((({{{(......))))))))).,}.))))))))))))...))))))))))...)))))..,......,{((((....((((((((.....))),,))))...((({.....}))).,..))))}},((((((((,...}))))))))|{{,,((({{((({.....)}))}))))),||{{{{.((((((...)))}))....((.....)}...(((((.......)))))...,{|{{|||{....(((((((........))))))).,.,{{{{..,|,|{{{.|||,,(((({{((((((((((({(.{((.,{{(({..,{((((....))))}.)}}.}}}..}}}.}||||{(,.{{{,{{{.{(({(((({,,,,,{(({,....,,...(((((((((((.(((.........))).)))))))))))...(((((((((((.,((((......}}))),,.))))))),,,,))))|||{....{|{.(((({{{(((((({......)))))))}.)))).}))|,.))))|||||..||{.(((((..,,,,.....,||,..,(((({.,,,..,,,.||}|}..,..}},}}..,,|{{,,,,)}|..,{|||,(((({...})))))))},)))}}}}..,}))},,..}))}}}}}|||||..|}))},..,{{{....,,,||}|,,.,|}}}||,,,,.})}}}})}}}})...))).)))),.|||||||{{{,,.,,||...,,,.{{||||,,,,...}}}}}}..(((((((.....)))))))...,...,,..{{(({{(.(({.(((((....))))).})))).})))}..,|,.{((((..{(((({{....}}.)))))..))))}.,,...}}|||||||}|}}}....))))},,.}...,.,},,.........,}}}}}.}))}}.,))))))....))))))))))))))))).((((((((({.......,))))))))){(((({.....)))))}{{.{{((((,...((((((.......))))))..|||}|||,....}}...}||,}},}})}}.,,))))))....(((((({(((((.((..({(,....)))..)){(((((...(((((((((((({..{((((((((((.{((.(((...})).))).)))..))))))}|,.,,.{{{({{{,{{,{|....,,.}}))).})))}},,,,...}))))))))))).)}.,.}))))}..........))))).}.)))))).((((((......((((....))))......)))))).((.(((((,...}))))).))......})))))},.|{{{...........}}}}.

Transcripts

ID Sequence Length GC content
AGAGUCGGAUUCGCCGCCGCAGCAGCCGCCGCCCCCGGGAGCCGCCGGG… 2147 nt 0.4238
Summary

The product of this gene is a subunit of neuronal microtubule-associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. Studies on the rat homolog implicate a role for this gene in autophagy, a process that involves the bulk degradation of cytoplasmic component. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the MAP1LC3B (MAP1LC3B-II/LC3B-II) expression is increased by methamphetamine in astrocytes, indicating induction of autophagy, and its upregulation is inhibited by circHIPK2 knockdown and MIR124-2HG overexpression [Huang et al. DOI:10.1080/15548627.2017.1356975]. In human sepsis patients, the MAP1LC3B (MAP1LC3B) exhibited decreased polyadenylation in viral compared to bacterial infection samples, as identified via Nanopore direct RNA-seq [He et al. DOI:10.1186/s12879-025-11078-z]. A study in mice demonstrated that the LC3B-II/LC3B-I ratio, a marker of autophagy, was significantly increased in Kupffer cells upon miR-5101 overexpression, indicating promoted autophagy during LPS-induced endotoxemic liver injury [Yang et al. DOI:10.3390/ijms241311210].