| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGUCGGAUUCGCCGCCGCAGCAGCCGCCGCCCCCGGGAGCCGCCGGG… | 2147 nt | 0.4238 |
The product of this gene is a subunit of neuronal microtubule-associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. Studies on the rat homolog implicate a role for this gene in autophagy, a process that involves the bulk degradation of cytoplasmic component. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the MAP1LC3B (MAP1LC3B-II/LC3B-II) expression is increased by methamphetamine in astrocytes, indicating induction of autophagy, and its upregulation is inhibited by circHIPK2 knockdown and MIR124-2HG overexpression [Huang et al. DOI:10.1080/15548627.2017.1356975]. In human sepsis patients, the MAP1LC3B (MAP1LC3B) exhibited decreased polyadenylation in viral compared to bacterial infection samples, as identified via Nanopore direct RNA-seq [He et al. DOI:10.1186/s12879-025-11078-z]. A study in mice demonstrated that the LC3B-II/LC3B-I ratio, a marker of autophagy, was significantly increased in Kupffer cells upon miR-5101 overexpression, indicating promoted autophagy during LPS-induced endotoxemic liver injury [Yang et al. DOI:10.3390/ijms241311210].