| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAAGGCUCGCAGCCACCUCUCGGGAGUGCAGGGCCAGAUCCUGUGCCA… | 818 nt | 0.4670 |
Predicted to enable microtubule binding activity; phosphatidylethanolamine binding activity; and ubiquitin protein ligase binding activity. Predicted to be involved in cellular response to nitrogen starvation and macroautophagy. Predicted to be located in several cellular components, including cytoplasmic vesicle; endomembrane system; and microtubule. Predicted to be active in autophagosome membrane. [provided by Alliance of Genome Resources, Jul 2025]
A study in human pediatric sepsis patients identified the MAP1LC3B2 as exhibiting decreased polyadenylation in viral compared to bacterial infection samples, classifying it among candidate genes with differential poly(A) tail length variation [He et al. DOI:10.1186/s12879-025-11078-z].