Basic Information

Symbol
MAP2K1
RNA class
mRNA
Alias
Mitogen-Activated Protein Kinase Kinase 1 MEK1 MKK1 Dual Specificity Mitogen-Activated Protein Kinase Kinase 1 MAPK/ERK Kinase 1 MAPKK1 PRKMK1 ERK Activator Kinase 1 MAP Kinase Kinase 1 EC 2.7.12.2 MAPKK 1 MEK 1 Protein Kinase, Mitogen-Activated, Kinase 1 (MAP Kinase Kinase 1) CFC3 MEL
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002755.4
Sequence length
2547.0 nt
GC content
0.5120

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-897.80 kcal/mol
Thermodynamic ensemble
Free energy: -941.58 kcal/mol
Frequency: 0.0000
Diversity: 601.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((..((((((((....)))))))).))....((((...((((((((.....(((((....)))))(((((.((.(......).)).)))))))))))))...))))))))))))((((((((((((..(.(((((((.((((....(((((((.((.......))..)))))))((((((((((((((((.((((....))))))))))((((...((((.((((((((((.(.(((((.((((((......))))....)).))))).)..))))..)))))))).))...)))).(((((((...((.((((((..((((((.(((.((((...)))).).)).)))))).)))))).)).)))))))))).)))).)))(((((.((((((....))))..)).))))).......((((.......))))((((.(((.(((((((((.(((((((......((((.((((.((((((((((...............)))))))).))...)))).))))..........))))))))).))((((((((((.((((....))(((((.(((....))))))))...((((...........))))...(((((((((((.((((((((((.(((.((((.(((..(((((.((.((((((((((((((((.....(.(((((((.(((.((((((((.......)))))))).))).(((((((.(((..((.((((.(((.(((................)))..))).)))).((((....))))..(((((((...(((((.(((((...(((((..(((.(.((....))))))...))))).....))))).))))))))))))(((((.((((...)))).).)))).(((((.....((((((((.....))))))))...)))))...((((((((....((((((.(((.....(((......((..((..((((((((.((((....((((((....(((...((((((.((((.(((((.((.(((((((..(((((....)))))..)))).(((((.......((((((.((((((...(((((.((...)))))))..(((........)))..((((((((((.((.((.(((((..((((((((((((((((((((....(((.(((((....(((.((..((((((....)).)))).)).)))..))))).)))(((((.((((..(((.((((....((((((.(.(((.((..((((((..((((...((((..((....))....))))(((((((((...((((.((((((......(((((..((((.((((.((((((((((.........))))))).....))).)))).))))..).)))))))))).))))........(((((((.(((.....(((...............)))..(((((((....((((.((.....)).))))))))))).))).))))))))).)))))))..))))..))).)))....))))).)))))))....)))).)))))))))))).......)))))))).)))).......))))))))...)).))).)))).))))))))))...)).)))).)))))).......))))).........((((.(((((......))))).)))).......((((..(((((((((((...(((...(((.(((((......))))).)))...........)))))))))))))).)))).....))).))))))).).)))))))))..)))...)))))))))).))))))))))..)).......)))))).))))))..))))))))))..))).)))))))))))).)).)......)).)))))))))))))))).)))))..).)).))))))).((((......))))......(((((..(((((.((((((.....((((((((...((((((....))))))..))))((((((....))))))((((((((((((...))))))...)))))).........))))....))))))..))))))))))..............(((((.......))))).))))).))))).)))))((((.(((((((((..(((((((((...(((((((((.......)))).)))))....))))))).....))..))))))))).))))...........)))))).........((.(((((....))))).)))).))))))))))......(((((......)))))((((((((...(((.....))))))))))).......))))).))).))))))))(((((....((((..(((((((((....))))).)))).))))........)))))....)))))))..)..))))))))(((((.........))))).....(((((((............................))))))).)))).
Thermodynamic Ensemble Prediction
((((((((({..((((((((....)))))))).||.,,,((((.{{((((((((,...{(((((....|||||{||||,)|.|.))),}}})),)}))))))))}}),..))}))))))))){((((((((((({.{,(((((((.((((....(((((((.,({{{....,)}})))))))((((((((((((((((.((((....))))))))))((((...((((.((((((((((.{.(((((.((((((......))))....)).))))).}..))))..)))))))).))...)))).(((((((...((.((((((..((((((.(((.((((...)))).).)).)))))).)))))).)).)))))))))),,))).)))(((((.((((((....))))..)).))))).......((((.......)))){(((.(({.(((((((((.(((((((......((((.((((.((((((((((.....,.........)))))))).))...)))).))))..........))))))))).)){{{{(((({{.{{(|,,,.{{(((((.(((....)))))))),,,(({{.........,,))))||,{{{{({(((((.((((((((((.(((.((((.(((..(((((.((.((((((((((((((((....,(.(((((((,(((.((((((((.......)))))))).)))..,,,,(({(((,,,|..,,{.|,,.|||}},,{{{{{,.....,{|{{{|||,}}}}}||{{.||,|}},.,||{{{{{.,.{{{{(,((((({{{{((({{,(((.,.((,...}|,}}}...))))).,},}))))).)))}})))))))||{((.((((...)))).),,}}..(((((.....((((((((.....))))))))...))))).{(((((((((....((((((.(((.....,((......({,.{{..((((((((.((((....(((((,,,{{((,...((((((.((((.{((((.({.(({(({(.,(((({....})))},,}}}}.(((((.,{{{..{(((((.((((((...((((({,,...},))}))..(((........)))..((((((((((.{{.((,(((((..({((((((((((((((((((.,{(((((({{.||}|},||.({.{((((....)))))}))),})})))}}})}},.||,(((((.((((..((({(((,(((.((((({,(.(((.,({{((((((..((((...((((..((....))....))))(((((((((...{(((.((((((...,,,(((({.,((((.((((.((((((((({{(,....}}))))))).....))).)))).))))..}.))))}))))}.})))..,,,||.{((((((.(({.....{((...............)))..(((((((....((((.((.....)).))))))))))).))}.))))))))).)))))))..))))..))).))),}}},,))).)))))))...)))))}))})))))))))...,}..)))))))).)})).,,,,.,))))})))...)),,)}.}))).))))))))))...)).)))).))))))}}}....}))))......,,.{(((.{((({......))))}.)))}..,....||||,.(((((((((({..{{({...(((.(((((......))))).)))...........}))))))))))))).}))).....})).))))))}.).)))))))))..))).}})))))))))).))))))))})..)).......)))))).))))))..))))))))))...}},)))}},)))))).)).}......)),}))))))))))))))).)))))..).)).))))))).((((......))))......{((((,.{((((,{{{{,,.,{{{((({((((...{{{((({,..,}))))}})))},{(((|,...|}|}}}{(((({((((((...)))))).,,))}|||,,....,,.)))).,}}))}))),.)))))))))}..............{((((.......))))).))))).))))).))))),,{{.{((((((((,.{,(((((((...(((((((((.......)))).)))))....)))))))...,.,}..})))))))).}}}},,,,,,.,.,.}}}}}}.,,||}}|}||}||||{....)))})},))).}}}}}|||||,,,,,,{{(((......)))),{{{{{{{{...{{{....,))))))))))},,,....))))).})).))))))))|,,,|.,..((((..(((((((((....))))).)))).))))......,.}}}}}....}))))))},),,}}}}})))(((((.........)))))..,,.(((((((............................))))))).}},,.

Transcripts

ID Sequence Length GC content
AGAGAAGCCAGCAAGUAGUUGAGUGUGACGGGUGCAUCGGUUCGGGUCG… 2022 nt 0.4619
AGUCCCUCCCAGGGCCGCUUCGCAGAGCGGCUAGGAGCACGGCGGCGGC… 2547 nt 0.5120
Summary

The protein encoded by this gene is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein kinase lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, this kinase is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. [provided by RefSeq, Jul 2008] CIViC Summary for MAP2K1 Gene MAP2K1 is a dual-specificity kinase known for it's involvement in the ERK pathway by activation of ERK1 and ERK2. MAP2K1 activating mutations have been observed in a number of cancers including ovarian, melanoma and lung. These activating mutations are generally found in the N-terminal negative regulatory region or the ATP-binding region of the N-terminal lobe. Inhibitors of MEK genes have been shown to inhibit tumor growth in these cases.

Forensic Context

A study in porcine skin demonstrated that bromine exposure significantly increased the MAP2K1 transcript at 24 hours post-exposure following a 45-second application, identifying it as a component of multiple signaling pathways including Acute phase response, EGF, IGF-1, Insulin receptor, Neuregulin, NRF2-mediated oxidative stress, PDGF, and Toll-like receptor pathways [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. A study in mice demonstrated that exosomes from hypoxic mesenchymal stem cells (Hypo-Exos) promoted bone fracture healing by transferring miR-126, which suppressed SPRED1 and activated the Ras/Erk pathway, including increased phosphorylation of MEK1/2 [Liu et al. DOI:10.1016/j.actbio.2019.12.020]. In a human forensic autopsy pilot study, RNA sequencing analysis of a fatal insulin overdose case revealed upregulated transcripts in the insulin signaling pathway, including those for the MAP2K1 [Nakao et al. DOI:10.1016/j.legalmed.2025.102772].