| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGAAGCCAGCAAGUAGUUGAGUGUGACGGGUGCAUCGGUUCGGGUCG… | 2022 nt | 0.4619 | |
| AGUCCCUCCCAGGGCCGCUUCGCAGAGCGGCUAGGAGCACGGCGGCGGC… | 2547 nt | 0.5120 |
The protein encoded by this gene is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein kinase lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, this kinase is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. [provided by RefSeq, Jul 2008] CIViC Summary for MAP2K1 Gene MAP2K1 is a dual-specificity kinase known for it's involvement in the ERK pathway by activation of ERK1 and ERK2. MAP2K1 activating mutations have been observed in a number of cancers including ovarian, melanoma and lung. These activating mutations are generally found in the N-terminal negative regulatory region or the ATP-binding region of the N-terminal lobe. Inhibitors of MEK genes have been shown to inhibit tumor growth in these cases.
A study in porcine skin demonstrated that bromine exposure significantly increased the MAP2K1 transcript at 24 hours post-exposure following a 45-second application, identifying it as a component of multiple signaling pathways including Acute phase response, EGF, IGF-1, Insulin receptor, Neuregulin, NRF2-mediated oxidative stress, PDGF, and Toll-like receptor pathways [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. A study in mice demonstrated that exosomes from hypoxic mesenchymal stem cells (Hypo-Exos) promoted bone fracture healing by transferring miR-126, which suppressed SPRED1 and activated the Ras/Erk pathway, including increased phosphorylation of MEK1/2 [Liu et al. DOI:10.1016/j.actbio.2019.12.020]. In a human forensic autopsy pilot study, RNA sequencing analysis of a fatal insulin overdose case revealed upregulated transcripts in the insulin signaling pathway, including those for the MAP2K1 [Nakao et al. DOI:10.1016/j.legalmed.2025.102772].