Basic Information

Symbol
MAP2K2
RNA class
mRNA
Alias
Mitogen-Activated Protein Kinase Kinase 2 MEK2 MKK2 MAP Kinase Kinase 2 PRKMK2 Dual Specificity Mitogen-Activated Protein Kinase Kinase 2 ERK Activator Kinase 2 MAPK/ERK Kinase 2 EC 2.7.12.2 Mitogen-Activated Protein Kinase Kinase 2, P45 MAPKK 2 MAPKK2 MEK 2 CFC4
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_030662.4
Sequence length
1727.0 nt
GC content
0.6543

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-776.30 kcal/mol
Thermodynamic ensemble
Free energy: -801.78 kcal/mol
Frequency: 0.0000
Diversity: 374.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.(((((((.((.((((((((.((((.....))))..(((.((((((..((((.(.(((((...(((((..(.((....(((((.....(((((((((((.((..((..((..(((...))).))..))..)).))))))))))).)))))..)))..))))).))).))).)))))))))).)))(((((.((((...(((((((((((((.((.((((((.(((((((((((((((((.(((..((.(((((((......)))).)))))))).)))).((((((......((.(((..((((((((.((.(......).)))))).)))))))))......)))))).(((.(((......))).))).((((............))))...(((((.((((...)))))))))..(((((....(..(((((..((((.(((.......))).))))....)))))..)..))))))))))))..))))))))))).).))....((((((......((((.((((((...((((((.((....(((((((...)).)))))..)))))))).((((.........)))).(((((((..((((....(((((((..(((.((((.(((.(((((((((...)))))))...)).))))))).)))....))))))).(((.....))))))).)))))))((((...))))........))))))..)))).(((((.(((....))).))))).....((.(((.(((.....((((..(((.((((((((((.....((.((((((..((((((((((((((..(((((.((((.....((((..(((..(((((.((.....((((((.((..(((..((((((.....))))))))).))))))))...)))))))..)))))))((((((...........)))))))))).))))).)))))..))))))))).......)))))).))...((((.((.((....)).)).)))).)))).)))))).)))..)))).)))))).))......))))))(((((....)))))((((...))))((((((.(.((((((((((......)).....(((((....)))))((((((..((((((((((.((((...(((.((((..(((((((((((..(((.....(((((((((((((.......(((((((...((((................)))))))))))........)))))))))...)))).....)))............((((((((.((((((...(((((.((...........)).)))))....(((((.((..((((.....(((.....((((((((((((..((...........))..)))))).))))))))))))).)).)))))((((.(((((.(((.((((((((.(((...))).)).))...))))...))).)))))))))..)))))))))).)))).)).)))))))))...)))))))...(((((((.........)))).))).))))))))))))))...((....)).....)))))))))))).)).).))))))))))))))))).))...)))).))))))))))))).)).)).))))).))))(((((.((((((...(((....))).....)))))))))....))...
Thermodynamic Ensemble Prediction
((((.(((((((.((.((((((((.((((.....||||,.{((.((((((.,((((.{,({{((...,(({{..{,({,,..,(({{..{{.(((((((((((.((..((.,((,.({{...))}.)}..))..)).))))))))))).))}}).,)))..))))).))).}))}))}})))))).)))({{((,((({...(((((((((((((.((.((((((.(((((((((((((((((.(((..((.(((((((......)))).)))))))).)))).{{{{{{...,,.((.(((,,((((((((.((.,......).)))))).))))}}})),.....)))))).(((.(((......))).))).((((............)))).{.{((((.((((...)))))))))}.(((((....(..(((((..((((.(((.......))).))))....)))))..)..))))))))))))..))))))))))),}.}}....(({{{{...,,|((((.((((((.,,((((((.((..,,((((({,...,}.))))).,)}))))}}.{((,..,......||||.(((((((..(((({{{,{((((((..(((.((((.(((.(((((((((...)))))))...)).))))))).)))....)))))))}|{{.....}},)))).)))))))|}}|}||},}}|.|}},..))))))..)))).(((((.(((....))).)))))..,,.((.{{(.(({,,...((((..(((.((((((((((.....((.((((((,.((((((((((((((..(((((.((((.....((((..({(..({{{((((.....((((((.((..{{{.{((((((.....))))))))).))))))))...)))))))..)))))))((((((...........)))))))))).))))).)))))..))))))))).......)))))).))...((((.((.((....)).)).)))).)))),,))))).)))..)))).)))))).)}....,.}))))}(((((....))))){{((,..))))((((((.{.{{{(((((|(|{{.,.||.,,,{((|||.},,)))||{{,,,|}}|(((((((({,((((,..(((.((((..(((((((((((..(((.....(((((((((((((.......(((((((.{{(,,,................))),)))))))........)))))))))...)))).....))),,.....,....(((((((({(((((({{{(((((.((...........)).)))))......}}}}}|.{((((.....((((....((((((((((((,{(({......})),})..))))))}}})))).,.)))).,,..))))}(((,(((((.(((.((((((((.(((...))).)).))...))))...))).))))))))),})))),,,))).)))).)).)))))))))...)))))))...((((,((.........))))}).}.)))))))))))))}...{{,...}},,|...}})),}})))),)),),))))))))))))))))).))...)))).))))))))))))).)).)).))))).))))(((((.((((((...(((....})).....))))))))}....}}...

Transcripts

ID Sequence Length GC content
CUCUCGGACUCGGGCUGCGGCGUCAGCCUUCUUCGGGCCUCGGCAGCGG… 1727 nt 0.6543
Summary

The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is known to play a critical role in mitogen growth factor signal transduction. It phosphorylates and thus activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, cognitive disability, and distinctive facial features similar to those found in Noonan syndrome. The inhibition or degradation of this kinase is also found to be involved in the pathogenesis of Yersinia and anthrax. A pseudogene, which is located on chromosome 7, has been identified for this gene. [provided by RefSeq, Jul 2008] CIViC Summary for MAP2K2 Gene

Forensic Context

A study in human forensic autopsy cases using RNA sequencing demonstrated that the MAP2K2 transcript was upregulated in a case of fatal insulin overdose, indicating activation of the MAPK pathway branch of insulin signaling [Nakao et al. DOI: 10.1016/j.legalmed.2025.102772].