| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUCGGACUCGGGCUGCGGCGUCAGCCUUCUUCGGGCCUCGGCAGCGG… | 1727 nt | 0.6543 |
The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is known to play a critical role in mitogen growth factor signal transduction. It phosphorylates and thus activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, cognitive disability, and distinctive facial features similar to those found in Noonan syndrome. The inhibition or degradation of this kinase is also found to be involved in the pathogenesis of Yersinia and anthrax. A pseudogene, which is located on chromosome 7, has been identified for this gene. [provided by RefSeq, Jul 2008] CIViC Summary for MAP2K2 Gene
A study in human forensic autopsy cases using RNA sequencing demonstrated that the MAP2K2 transcript was upregulated in a case of fatal insulin overdose, indicating activation of the MAPK pathway branch of insulin signaling [Nakao et al. DOI: 10.1016/j.legalmed.2025.102772].