Basic Information

Symbol
MAP3K5
RNA class
mRNA
Alias
Mitogen-Activated Protein Kinase Kinase Kinase 5 MAPKKK5 ASK1 MEKK5 Apoptosis Signal-Regulating Kinase 1 MAPK/ERK Kinase Kinase 5 MEK Kinase 5 EC 2.7.11.25 MEKK 5 ASK-1 Apoptosis Signal Regulating Kinase 1 MAP/ERK Kinase Kinase 5 EC 2.7.11
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Individual identification

MANE select

Transcript ID
NM_005923.4
Sequence length
5157.0 nt
GC content
0.4592

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1615.20 kcal/mol
Thermodynamic ensemble
Free energy: -1716.52 kcal/mol
Frequency: 0.0000
Diversity: 988.89
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((((((((((..(((((..((.((((((((((((((.(((((((((.(((((((....(((((.((((.........)))).)))))((((((..(....)..))))))..((((.(((.(((((.((...)).))))).))))))))))))))..(.((((........)))).)(((..((((((((.((((((((((.(.....(((((((...(((.(((.(((.((.(((........))).))))).))).)))...))))))).....).).))))).)))).))))))))..)))))).)...)))))..))))).))))).)))).))..))))).(((((((((.((((((((((((((.............)))))))).)))(((((((((((((((((.(((((((((((((((..((((.....)).)).))..))))))))))))))(((((((....((..(((.....))))))))))))((((((......(((((.((((..(((((.(.(((((.((..((((....))))...)).))))).).)))))..)))).)))))..(((((((....((.....))((((((..(((...(((..(((((((..((.((((((((.((((((((.(.((.((((.(((((.((......)).)))))..)))).)).).)))))....)))...)))).)))).).)..)))))))))))))..)))))).....(((((((((((((((((.(((((((.....((((....))))(((((.(((.(((((((.......))))))).).......)).)))))......)))).))).))))))))))).............)))))))))))))............))))))........((((((....((((((.........))))))))))))....))))..........(((.((....)))))((((((((...((((.(((((.((.......)))))))...))))))))))))....(((....))).....)))))))))))).(((......)))....)))))))))))).((.((((((.((((((..((((.((..((..........))..)).)))).....(((.....)))))))))..)))))).)).)))).)))))))))...)))))...(((((((((..((((.(((((((......((((((........(((((.........)))))))))))))))))).)))).....((((.((((((((.((..(((((............(((((..(((((((((((.((((...))))...((((...(((....))).))))..((((....)))).(((((..(((((....))))).......(((((((.((((..(((..((..(((((..((((.(((((((......(((((..((((........((.((((...((((((((.((((..(((((.(....))))))..)))).))).))))).)))).))))))..))))).....))))))).))))......(((((((...........((....))))))))).(((((...((((...((((((((((...(((((........((((((....((((((..(((.(((......)))))).))))))....)))))))))))...))))....))))))...))))...)))))))))).))...)).)..)))).)))))))(((..((((((((((((((((((...(((((..((((...)))).((((((.(.((((((..(((((((((((((((.(((.....(((.((((((((((((((((((...(((((((..((((....)))).((((...(((......))).))))..)))))))........)))).))))))))).))))))))..))))))))))))...........................))))))....)))))).).))))))...(((.....)))((((((.((.((((((((..(((((.(((((((((...((((......)))))))))).)))))))))))))))).))....)))))).(((((((((......)))))))))((((...)))).(((((((((..............)).)).))))))))))...))))))))))))).))))).))).)))))..............)))))..)).)))).)))))(((((((..(((((.(((.(((((..((((((.((..(((.((....)).))).)).)))))))))))...))).))))).....)))))))..((((((((((((((((((((...((((((.(((((.(((((.(......((((((((((.(.((....(((((((...(((((((((((((((..((((((...((((..(((((...........((((((...))))))((((((((.(.((...(((((((.((....)).)))))))...))))))))))).((((((((.((((((((((((((....((((((((((......((((.........))))(((((.....)))))...((((((((((((....(((.((((.(((......((((.((((..((((.....((((((((...((.((((..((((((......)))))).)))).)).(((.((((..((((((...((..(((((.(((.......(((.((...........((((((......))))))((((((.(((((..............(((((.((((((.(......).)))...).))))))))))))))))))...((((.(((((((.....((.....))))))))))))))).)))....))))))))..)))))))).)))).))).........)).))))))....)))).(((((...((..(((.(((((((((((((((...)).)))))))))...(((...)))........)))).)))..)))))))((((((((.((..(((((....(((...)))......)))))..))))))..)))).(((((((.....))))))).....)))))))))))))))))))))))).)))))).(((((((((((.....)))))))).))).(.(((((...))))).)((((((((...))).).))))))))))))))(((((((((.......(((((((.((.(((..((((((((.((((..((....)).))))))))))))..)))((((((.(((.....(((....((...((..((.(((((((..(((((((..((...))...)))))))..((((((..(((((((..(((((((((.....((((((((.((((((.((.....(((.......((((((....((((.(((..((((((((((...)))))))))).))).........))))......))))))......)))....)))))).)).)))))))).....(((..((((...((.((((..(((.....(((....)))...))).)))))).)))).)))...((((....)))).(((((((((((......(((((((.((((.(((........))))))).))))))).........))))).)))))))))))))))((.(((((((((((....(((.((....)).)))...((((...))))..((((..((((((.........))))))..)))).)))))))))))))...((((....))))(((...((((.((.((....))..))..))))..)))..))))))).....))))))(((((((((..((..((((((((...(((.((((((((.((((...........))))))))))....)).))).)).)).))))..)).)))).)))))..))))))).))..)).))...)))....))))))))))).))))))).)))))))))...........((((((((((.........))))).......(((((((((((..(((.....((....(((((..(((.(((...(((..(((((..(.((((((...(((........)))...)))))).)..))))).))).(((((((((((((...((((.................))))...))))))))...)).)))(((..(((..(....)..)))..)))..(((((...)))))....(((((.....))))).))).)))..))))).....)).....)))((((((.......).)))))......(((((......)))))((((..............((((...))))............)))))))).))))))))))))))))...)))).)))))).))))))))...............((((...(((((..((.((((............))))))..))))).))))....................................(((.((((....)))).)))((((((..(((((((((((((....)))))))))))))..))))))..(((((((...((((((..(((((((...((...(((....(((((.(((...(((((((...(((.........)))...)))))))....)))..)))))...)))...)).....)))))))..)))))).)))))))))))).))))...)))))).(((((.........)))))(((((.....)))))....(((......)))...)))))))))....))))))...)))))))...)).).))).).))))))).))))).))))).)))))).....)))...)))))).))))))))))).((((((...............))))))..))))))).)))))))).)))).........((..((((((.((((((......))))))..))))))..)))))))))))...........(((...))).......
Thermodynamic Ensemble Prediction
..((((((((((((((((((..(((((,,((.((((((((((((((.(((((((((((((((((.,,,(((((.{{{{......,,,))}),}}}}}((((((..(....}..)))))).}}.}},|||.((((({(({..,|.,||{|,}||||||,,,,,,)})))}))}}..,....))))})|||{|((((((((.((((((((((.(.....(((((((...(((.(((.(((.((.(((........))).))))).))).)))...)))))))..,,.).).)))))}}))).)))))))).})))))).,...)))))..))))).))))).)))).)).,))))).((((((((({((((((((((((((..........,..)))))))).)))((((((((((((.,((,,(((((((((((((((..((((.....)).)).})..))))))))))))).(((((((....((..({{.....)}}))))))))).{(.(((((...(((((.((((..(((((.(.(((((.((..((((....))))...)).))))).).)))))..)))).)))))..))))).)}..{{({......((((((..(({..,(({..,((((((..((.((((((((.((((((((.(.((.((((.(((((.({......}).))))).,))}).)).).)))))....)))...)))).)))).).)..)))))))))))))..)))))),.,...(((,,,.,}))((((((((((((({(((.((((....))))..))),}}}}))))))))))...((((..((((..(((.(((({{(({.,,........((((...,.((({,.....{{((({...}))).)))))).}.))))......},)))),..,,....((((((....((((((.........)))))),,}}}}.......}}}},,.....,}|...})))).))){(((((({...((((.(((((.((.......)))))))...))))))))))))))))..))))..,}.)),.)))))))))))).{{,......}}}....)))))))))))).((.{(((((.((((((..((((.,{..((..........))..}}.)))).....(((.....)))))))))..)))))}.)).)))).)))))))))...)))))...(((((((((..,(((,((((((,.{(((.{({{,,{{{{{{..{(((|,..{{{{..,,,))}},,..))))},)}))))...,,|{{{..||||{{,}||}}|||,|.......{(({{,,,,,...|||||(((((.(((({,.||||.,,{{{{...(((....))).}}},..((((....)))).|||||,,(((((....))))}{|,....(((((((.(((({{.{{..((..(((((..((((.(((((((....,.(((((..((({....,,,.,,.{(((...(((({(((.((((..(((((.(....))))))..)))).))).})))).))))}))))))..))))).....))))))).))))......(((((((...........{{....}}))))))).(((((.,.((((...((((((((((...(((((........((((((....((((((..(({{(((......)))))).))))))....)))))))))))...)))),...})))))...))))...)))))))))).))...}}})},,})).)))))))|||,.{(((({((((((((((((...(((((..((({...}))).((((((.(.((((((.,(((((((((((((((.(((.....(((.((((((((((((((((((..{(((((((..((({....)))}.((((...(((......))).))))..))))))}..,...,.)))).)))))))))}})))))))..))))))))))))...........................)))))}..,.)))))).).))))))...{{{.....}},,,||{(,((.((((((((..(((({,(((((((((...{(({......))}})))))).)))))))))))))))}.}}....}},,,,.{((((((((......)))))))))||||},.}}},.,{{{{{,({,......,,,....||,,,.})))})))))...))))))))))))).))))|{|||..,}},}},,|.........)))))..||{|||,{||,}}(((((((..(((((.(((.(({((,.((((((.((..(((.((....)).))).)).))))))))))).,.,}).))))).....))))))),{((((((((((((((((({{(...((((((.(((((.(((((.(......((((((({((.(,({....(((((((...((((((((((((({(({((,{{({{((((((.(((((....,......((((((...))))))(((({{{{.|,||,{{(((,(((,.....{{|{|,|||,,...)))}))))))}.((((((((.((((((((((((((....((((({{,.((((((.((((.........)))).|))}}}.....|||{{....((({.,(((......)))))))....(({((,((,,.(((((...........))))),.,)}),)))})}....(((.,..(((((((((.(((.,,...,,))).)))))))))..,))).}))))}}.....))))){((..(((((((((((((((,.....}}}}},..{||.}||}}..............||.||,..,|(({.......|||.(((((((..{((.(((((((((((....(((,,(((((((.....((.....)})))))))))))..(((.....)))...})))}....{(((.((((((..,........)))))).)))}..,)))))).))))))))))...({.(((((((((({...})})))))))))..}|.,.{{||{,,,||.|||,}}||,,,.,}|.|},,)))}))}.,..},,,.}}))))))))).))}............(((..((((((...((((((((.((((.((((((..((((((.((((((((.....)))).((({,((((((((((((((.....)))))))),))),,,...))))))){((.(((((((((...))).),})))).))}..((((((((((((....((.((......)).))....)))))))).....))))..{(((((..{((,,(((((,...,))))).))),..))))))..{{{(,.((.((((((((..{.(((((((..{{...}}...))))))).}..))))}}))))}})),(((((..((....,((({(((,.,,|,...||}...}}.........|}}}||}...{{....||..((((((((((...)))))))))).}}........,{{({{..............),}}}}))..))))).))))))))))..)))))))))).((((({{(.((((((.(((((.(((((.(((........,.((((........)))),.{(((....)))}{{{.((((((.,,.{{{(((((((({,,...(((........||,((((((((..,,.((((((.((.....)).)))))),,..((((.(((((((((((....(((.((....}).)))...((({...})))..((((..((((((.........))))))..)))).))))))))))))))).((((....))))|,,...{,{{.((,,,.,{{||..,,..)))),.,))......)))))))),||((((((((((((.,,(.,((((((((.,.(((.((((((((.((((..{{,...,}}))))))))))....)).))),)).))},))},.}).)))).))))))))|,{||{{,......,.,{(((((....,....,....})))))||.,...,,,.............},.))}))).,|,}}}..)))),,...,})))))))}.......))))))..}}},..(((((..(((.(((...,{{..(((((..{.((((((...(((......,.)))...}))))).)..))))).}},.,,.,,((((((((...((((..,...........,..))))...))))))))..})).,||{{{.{{{,{,,...,}||}}},,},...{{{{{...}}))).,,.(((({.....))))).))).)))..)))))))).)).))).)))))..)))))).}})...))))).....(((((......)))))..,,.,{{........}}},)}..................))))))))....)))))).)))))))...))))))))))).))))))))((((((..,{{{,..((((...(((((..((.((((............))))))..))))).))))..................(((((((((({.,{{{{(((,.((({....}))).))))||||,..(((((((((((((....))))))))))))){{||,,,.}}}}........}))))))))))..}}}},))))))......(((((.(((...(((((((,{{,((.........))).},)))))))....)))..)))))....{((.......}}}.}})),},)))}...}}}}}.,))))).).)))))))),,,.{((((.........))))),,,(({{{{{||,,,.}})}}.}}}}...}}...)))))))))....))))))...)))))))...}}})}})}.,}))))))}.))))).))))).)))))).....})),..))))))))))))))))),}||(({,..{{{{{{{,,,...||||}|.{|||,,,,.,,,)))),,})))}}}}}))}},|,,}|{{{{.((((((......)))))),}),))))}}..)))))))))...........{{{...)}).......

Transcripts

ID Sequence Length GC content
GAGCCGACUUGUCAGCCGGCCAAGAAAAGGAAGCUCCGUCCCUUCCCGC… 5157 nt 0.4592
Summary

Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the MAP3K5 gene was overexpressed in the ventral midbrain of a methamphetamine high drinking line compared to a low drinking line, indicating its association with differential risk for voluntary methamphetamine intake in the absence of drug exposure [Hitzemann et al. DOI:10.3390/brainsci9070155]. In human conjoined twin fetuses, the promoter region of the MAP3K5 gene was found to be hypermethylated in one twin, revealing significant local epigenetic differences related to growth and development between the twins [Chen et al. DOI:10.1016/j.rbmo.2023.03.001].