| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGCCGCCCCGCGCCGGCUCCGCAGCUCGCGCCCGCCCGCCUGCCGGCC… | 7123 nt | 0.5402 | |
| GCGCCGCCCCGCGCCGGCUCCGCAGCUCGCGCCCGCCCGCCUGCCGGCC… | 7147 nt | 0.5406 |
The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
A scoping review of human twin studies found that the MAP4K2 was mentioned in the introduction and discussion as a gene for which decreased DNA methylation was associated with higher birth weight in a singleton epigenome-wide association study meta-analysis, but it was not studied in the twin research included in this review [Dany Laure Wadji et al. DOI:10.1371/journal.pone.0315549].