Basic Information

Symbol
MAP4K4
RNA class
mRNA
Alias
Mitogen-Activated Protein Kinase Kinase Kinase Kinase 4 HGK NIK FLH21957 Hepatocyte Progenitor Kinase-Like/Germinal Center Kinase-Like Kinase MAPK/ERK Kinase Kinase Kinase 4 HPK/GCK-Like Kinase HGK Nck-Interacting Kinase MEK Kinase Kinase 4 EC 2.7.11.1 Epididymis Secretory Protein Li 31 Ste20 Group Protein Kinase HGK HPK/GCK-Like Kinase EC 2.7.11 HEL-S-31 KIAA0687 MEKKK 4 MEKKK4
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis

MANE select

Transcript ID
NM_001395002.1
Sequence length
7970.0 nt
GC content
0.4695

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2542.55 kcal/mol
Thermodynamic ensemble
Free energy: -2694.47 kcal/mol
Frequency: 0.0000
Diversity: 2214.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((....(((((((..((((.((((.((((.((.(((((....)).))).)).)))).)))))))))))))))(((((.(..((((.(((((((.....(((((.((((((.((((...(((((((...))).)))).)))).)))).)).))))))).))))).)))).))))))(((((.((((..(((((((.((((((..(.(((((((((((((.(((...(((.((((((....)))).)).).))....))).)))))))))).))).)..)).)).)).)))).)))....)))))))))..........)))))).((((((((((.(((((..((((((((((....))))).((((((((..(((.((((((((..((((..((((((((.(((((((.((((((.((((((.(.((((.......((((((((((((((.....(((((((....((((.((....((((.(((.((....)).))).)))).....)))))).....)))))))..........(((((..(((..(((((.(((......................................)))))))).)))..)))))((((((((((.((((.(((..(((......((((((.((((((((((((((((....))).)))))))...)))))).)))))).(((..((((((((...((((((((...((((((.((.(.((.((......)).))).)).)))...(((((..((.....))..))))).)))....))))))))....)).))))))..)))..)))...))).)))).))))))))))...(((......)))....(((((((.((((((......(((.(..((((((((..((((.(.(((((..((((((((.((((((((((...........(((((((.....))))))))))))))).(((.(((....(((((((...((((((....))))))...))(((((((((......)))).))))))))))...))).)))...(((((..((.........))..))))).))))))))))..))))).).....))))..))))))))).))).......))))))..)))))))...(((((.((((.((((..((((((........))).)))..)))))))).)))))...((((((.....((((((((..((......))..))))))))....)))))).)))))))))))))).....)))).)..))))..)).)))))))))..........((((..........))))(((.((((((...((((.((((.....))).....((((((((((((((((......((..(((.(((.((.((((((.....((((((((((((((((.........)))))))((((((...((((((((((((..((((..(((((((((((((((((((....)))))((((((((..................((((((.....((..(......)..))...))))))..........(((....))).....(((.(((((((((((((....((((((((((((((((((.....((((((.(((.((((((.((((..........((((((................)))))).....((((((.((((((((.((((((.....(((((((.(((((((((..(((((.((((((.(((((.(((....)))......(..(((((.((..(((((.((((((((((....))))((((((..(((.....)))..))))))((((..((.(((..............))).))))))))).))))))))..)).)))))..)........).))))))))))))))).))))..........(((((.((....)).)).))).......((.(((((.((.((..((((((((.((..(((((.(((((((.(((((((((((...((((((...((((((((.........((((((((((((..((((((((.(........((((..((((..((((((..........(((((((((..((((((((.........(((((.....(((((..((......((..((((...((((.((((.((((........)))).))))...))))))))..)).))..)))))......)))))..........))))))))..))))))).))..........))))))...(((((((........(((...((((.(((.((((((((.....((.(((((.((.(((.((.((((((((((..(((((.(((((((((...))))))).))..))))).....(((....(((((((((.(((..(((((.(((((((.((((....)))).)))((((((......)))))).....)))))))))..))).))))..((((((((...)))))))).(((......(((((((.((.((((...(((.(.(((((((..(((((.((((((..(((..((((((.(.((((..((((.((((.......)))).))))..)))).).((((((.........))))))...((((((.(.(((.(((.....))).)))).)))))).....(((((((.(..(((....)))..).))))))).))))))....))).))))))........((......))((((((((.........))))))))....)))))..))))))).).)))...)))).)))).)))))......))).)))))..))).........)).))))))))...))...)))..(((((((((...))))))))).)))))))..)).....)))))))).))))))).))))))))))........((((......))))((((((((.(.......).)))..))))).....))))..))))....).))))))))......((((......))))............((((.((((((((((..........((..(((((.((....(((.((.........)).)))....)).)))))..)).)))))(((((....)))))))))))))).))))))))))))....(((((..(((((...((.(((((((.(((((((...((((((((....(((((...((((..(((((((......((((((.(((((((((((((((((((.((((((.((.....(((((...(((((....((((..(.(((((((((((..((((((...((((((((..(((((....((((......(((((((((((((((((...((((.(((.(((.....((((.((((((((((((((...((((..((....))....)))).))).)))))))))))))))..((((.((((....................)))).)))).((((((...(((.(.....................).)))...)))))).....)))))).))))...)))))))...)))))).))))))))...)))))(((((.....(((.....)))....))))).((....((((((((((((......((....)).(((((((...(((((((...((((((((.((.((((.....))))...)).)))....(((((((((............))))))))).................)))))..))).))))...)))))))..)))..)))))))))..))))))))))...)))))).)))))...(((((....)))))....(((.....)))...)))))).)..))))............))))))))))..))))))))......((((((.........)))))).....((((((((((((...((((......))))....((((...(((((....)))))...))))((((((...((((((((.((((((((((.(((((((((((.......))).)))))))).).)))......(((((..((((((........((((((((.((((.(((((((..(((..(((((..(((((((.......)))...))))....))))))))............)))))))))))..))))...)))).(((((.....(((((((...((((.(((((.(....).)))))....))))..))))))))))))............((((.(((((((((((((((..(((.((((.(.(.((.....((.(((((......((((((((((((......((((...)).))........))))))))))))......))))).))....)).).).))))))).))))).((....(((((........)))))...))....)))))))))).))))))))))...))))))))))).))))))))))))))(((.((((...)))).)))...((..(((((((........(((((((.(((...((((.((((((((((((.....))).)).)))...))))..)))).(((......)))(((..(((((.....((((((((((..............................................((((((...))))))((((............))))....)))).))))))....)))))..))).........((((((.......)))))))))))))))))))))))..)))))))))))))).))))))).))))))))....)))).))).)))........)))))))...))))..)))))....)))))))).))))))).))....))))).))..)))))....)))))(..((((.((((((.(.........).)))))).))))..)..(((((((((((.(((((....)))))..)))))))))))...))))))))(((((((((...((((.....((((.....)))).....)))).))))))))).)))))).))))))))))))))).(((..(((((((.((..((((((((...(((((.(((((((((..((((.(.(((((......((.(((........))).)).))))).).))))((((((......)))))).................................................(((((((...((((((((.....(((((.(....(((...((((((((((..((((..((.((((((...(((..((((((((((...((......))..))))))))))..)))....(((((....)))))...(((((((((((..((((.....)))))))))))))))((((..((((.(((.......))).))))))))((((.((((...(((((..(((......)))..)))))..)))).))))..................)))))).)).)).))..))))))))))...)))).))).)).(((((((((((....))))....(((((....)))))..)))))))..................))))))))..))))))).))))))))).....)))))..))))))))..))..)))))))..)))....((((((((....))))).)))))).))))).)).........((.(((((.(((((((.......)))))))))))).)).....))))))))))))))))).))..)))))))))))).....))).((((.......((((((((.((((((((......))))..)))).))))))))))))((((.(((((........))))).))))..))).)))))))).))))))..)))).)))))).))).))))))..........((((........))))....(((.((((((((...)))))))).)))((((.......))))((((((....))))))(((((((((((((....)).............(((((((((((((((((.........)))))))..)))...)))))))......))))).))))))..............(((((((.........))))))).........)))))))))))))).))))...))))))))))))).))).(((((((........).)))))).(((((...))))))))))))).((((((........(((.((.(((((.(((((...((((...(((((((((((((((((((((.((.(((((...((((((.(((((..((((((((((((...(((((....)))))..((((........)))).......((((((((((.((.(..(((.......))).)))))))....)))))).((((.((((..(((((....))))).)))).)))).......)))))))))))).((((((((((((((.((((((....((((....((((((((....)))..((((......))))(((((((.....))))))).........((((((((.(((....))))))))))).(((((......((..(((((.((((((....)))))).)))))...)).......)))))..)))))))))))))))))))))))))).)))..(((.((((....)))).)))....)).)))..))))))...))))).))....))).....))))))(((((((...(((........)))))))))).)))))))))))))))))))).).))))))).)))((.((((((.......))))))))..((((.((......)).))))((((........))))............(((..(((((.(((....))).)))))..)))(((..(((((.(((.....))))))))..))).((((((((((((((((.(((((((....)))))))..)))).)))).))))).)))))))))((((.....))))..))))))).))))..)))..)))...)..))))).............)))))))...))))))...))))))))))))))))).))).)))))...)))))))))...)))))))).))))..)))))).))).)))).))))))))...))))......((((((.((((((........)))))).)))))).....))))))))))).........(((((((((...)))))))))))))))))((((.....)))).....((((((....))))))((((...))))...............((((((....(((((...((.........))..))))).)))))).(((((....)))))..))))))))))))))))))))((((...((((..(((((((..((((((....((((((((.((((((((((((((......((((((...))))))......))))))(((((((..((.........))..)))))))............)))))))).)))).((((((((((((........))))....((((((((((((.....)))))))))))).....((((...(((((((.................((.((((...)))).))(((.((((((....((((........))))....)))))).))).....)))))))...)))).((((((((((.(((.((..........)).)))...))))).))))))))))))).))))))))))..)).........................))))).....)))))))).
Thermodynamic Ensemble Prediction
..((((((..,,(((((({.{((({{((((.((((.((.(((((....)).))).)).)))).)))))))))))))))|((((.{..((((.((((((({,..,(((((.{(((((.((((...(((((({...))).)))).)))).)))).)).))))))),})))).)))).}))))|(((({{((((..(((((((.((((((..(.(((((((((((((.(((,..(((.((((((....)))).)).).))..,.))).))))))))))}})).)..)).)).)).)))).)))....)))))))))}.........)))))).((((((((((.(((({.,((((((((((,.,.}}}},.((((((((,.((,{((((((((..((((..((((((((.(((((((.((((((,({((((.{.((({,((.,,.((((((((((((((.....(((((((..,,((((.((,...((((.(((.{{....}).))).)))).....)))))}.,,..))))))){..,,,,...(((((..(((..((((,,(((.......,,.............................)))))))).)))..)))))((((((((({.((((.(((..,{{......((((((.((((((((((((((((....})).))))))),..}))))).)))))).(((..{((((({|...((((((((...((((((.((.{.((.((......)).))}.)).)))...(((((..((.....))..))))).)))....))))))))....}}.))))))..}))..))}...))).)))).}))))))))),,,||,......|||{{{{(((((((.((((((.,....(((.{..((((((((..((((.,.(((((..((((((({.{{((((((((....{{,...|(({{(({.,.,.))}}}}})))))))),|{,.,{{..{{(((((((,,.((((((....))))))..,))|,,.|||||}},...|||||.,,,))))),...|||{|||...{(({{{{{(.......,,}}..)))))}))))))))))..))))).,.....))))..))))))))}.))).....,.))))})}.)))))))...(((((.((({,((((..((((((........))}.)))..)))))))).))))).}))))}}...,.{((((({{{.,||,,...,||..}}}}}})),..,}}.....)))))))))))))).,,}))))).}..)))).,)}.)))))))))..........((((........,.))))(((.((((((...((((.(,(({,,..|||....,((((((((((((((((......((..(((.(((.((.((((({...,,((((((((((((((((.........)))))))((((((...((((((((((((..((((..(({((((((((((((((((....)))))((((((((....,,,,,,..,,,...((((((.,.,.{{..(.....,}..))..,))))))......,...(((....))}.,,.,(((.(((((((((((((....((((((((((((((((((..,,{{{{{{|,(((,{((((({((((,{({...{,{({((({.......,,.,.....}}|}}|...({((((((,((((((((.((((({{{{{,(((((((.(((((((((..((((,,((((((.(({({.(((....))}......(,,(((((.((..(((((.{,{,|||||{.,,.))))||||{(.,(((..,..))},.))||||((((..((.(((....{.......,.))).)})))},,}.}))))))}.|)).}}}}}..,..........}))}))))))))))).)}))....,,...,||||(,{(,,,,||.||.||,||,,|{|((,((,((,((.((,.,{{{{{(({(({{(({..|||{((((.(((((((((((...((((((...{(((((((,......,.((((((((((((,,,..,.{(((({....||,,....,|,|,.}}}},,({{..((({....)))).))),{.{{{{{((.|||.|},||||||.,,.{.,,.,,||},}}},||,.{|||..|((((.((((.((((........)))).))))...)))))|||,,|||||.}}})},},}}}||{||{||,|,..,,....,|||||,||||}||||},.,,....},|,{({{{..(((((({........(((...(((,,(((.((((((((.,,{{{,.,||||.{(,{{({({.((((((((((,.(((((.(((((((((...)))))))}})..))))).....({,...,|{{{{((({.{{(..{{{{{.{{{,{({.((((....|||}.}}}((((((......))))))..,,,|}|||||||..|||.}}}|,.((((((((...)))))))).{{{......(((((((.((.((((...(((.(.(((((((..(((((.((((((..(((.,((((((,(,((((..((((.((((.......)))).))))..)))).,.((((((.........))))))...((((((.{,(((.(((,...,))).)))).}))))).....(((((((.(,.(((....)))..).))))))),)))))).,,.))).))))))........{{......}}((((((((.........))))))))....)))))..))))))).).)))...)))).)))).)))))......}||,|}}}}..}}),,,......})}})))))))...||...|,},,(((((((((...))))))))),}))))))..)),},.,)))))))).))))))).))))))))))))))).}.((((......)))){{{{(({{.{,.,....|,|||,,|}}}}....,|}}|,{{(((,,.{{((..,}}}},...}})}}|,},,},},,)||||}}|.{,..(({{{(({(((,({,..,,.,....||..(((((.({..,.(((.{{.........)}.)))....)).))))).,}},|,.}},{{{{.,,}))))})})))))}}.}))})))))))),...((((({.(((({...((.(((((((.(((((((.{.((((((((..,.(((({.,.((((,,((({({(,.....((((((.((((((((((((((((((({(({{{..||,..,|{|,{{,,.(((((((((((,,((((((,{,........{(({{(({.(((((((({.,,.....,{{,((,.....(((((((((,(((((.....,.}}},,....,.}}.}))))))))|||,|||,,||)))}.}))}.)))....,,.,((((((((({.||,,||.|({((....((((.((((((..,(((..........,))},.)))))).))))......)})),}..}},,..{{({,,{{((((......)))).....))))))).}))))))))))))))))...))))))))))}}.{{|||{|,(({({,.{{,{((({{{{{|..{{,|||{{((..,,({{,,{{|{{|,.,,..,,.{{{{{{.,((((,,...|||||||.}}||||||{|,||.|{||}}}}}})),...)),)}}....(((((((((...,,....,,.))))))))){(.{(((({{.,,...{{{{{.........,,}}})),||{(((({...(((((((((....||((((((...(((((({||||{({{,,.......}))}..,,.|,,.{,,,|,..,|||}||{{{{{||||{{..{{{.{{{.,,,))),))).,||,,}})),.,,..((((((.........)))))){{{{{({,,,|||||||,..((((......))))...{((((...(((({....}))))...))))|,(((,{,,(((({((,{(((({,((((.(((((((((((,,....}}))})))))))).).}}),},,}}|||||}.||{|||....{,,,({{{((((.((((.(((((((..,{,.,({(({,,{{{,{({...,,,,}|}...}}}},.,,}}}}}}}}.,.}}.}}},,.)))))))))))..)))),,,)))),|||||},,,.|||{{{{||}||,,.,,((({({{{{,,|||||,,.,||}||{|||||}}|||||..,{,....,{.((((.(((((((((((((((,,({{.((({.|.|.((.....({.(((((,.....((((((((((((..,..,({.,....,.}}....,}..))))))))))))....},))))).,}..,.)).}.}.))))))).))))).{{.{{,(((((........)))))..}))....)))))))))).)))),)),},.,,}}}}})))|||,}}}|}}}}||,}||{{{,||||||,}},},}))}},,|}}|||.,{||..,...,||}||{|}||||||{|,{|,|{(|...}},}},}}))}}})})))),,|}|,,,,}}},,))}})))}})))}})))))).,.)))))),}}.,....)))))))))..))))))))},.}})))))..)),......,.,..{(((((...)))))}|{|{||||||||,{.,{|||,,,,)))},,...,},}},}}}}}}|}))}},},,...((((((.......)))))),}})))}}}},,},,))..,)))))).,,}}},.))))))).))))))))}...}))).))),}))....,}..))))))}...,)))..))))).,..))))))))}))))))).))....))))).))..))))),,,.)))}}|},|{,{,(((,{(,{..,,,....},)))))}.,)))}.|,{(((((((((((.((((,....}))))..)))))))))))}.,)))))))}{((((((((...(({{,,{..((((.....)))).}},.}))}.))))))))).)))))).)))))))))))))))))),,}||{((|{.,{,,,{|||{{{||}|||||,|,||,||}|)))))||{|,(((((({,,,((.{{{........}}},||{{,,{{((,{|..,}}}..}||||,,||}||||...............................................,....,,{(((({...})}}}}.}))))}}.,}}|{{{|,(({(((((({..{(({,,((.{{{(((..,(((,,(({{{{{{{|,,,||,,....||,,||}}||||||..||}.,.,(((((....)))}},,,(((((((((({..{{{{.....)))),)))))))))){(({..((((.(((.......))).))))})))((((,((,({(.(((((..(((......)))..))))).))),),))))................,,)))))}.)).}),)),,)})))))))}...||||||||....,.|||||({{{....)))),...,{|||,...))))).}}}}||},.,,.....,,.||||{{|||,,.,|,|||||}}}|||||}}}|||{{,..,},}}}})))})|||..}},,||}}},}.,|||....{({{{{{|.,,,})})).})},))})))))})}}}}}}}}})}|,{{{{{.(((((((.......)))))))))))),))||||,}},,})))))})))))|})|..}))))))))))).....|{{...}}}......((((((((.((((((((......))))..)))).))))))))}}}))))))}},,,,,.||}},..,,)}.,,,,)))),)))))))).))))))}.)))}.))))))})))}))}))),..........,,,.......,||,....,(((.((((((({...}))))))).)))|,,,,,..,{{||||((((((....))))))(((((((((((,,,,,,||,.......|.,..(((((((((((((((((.........)))))))..)))...)))))))...,..))))).))))))},,,,,..,.....(((((((.........))))))).....,...)))))))))))))}}})))...))))))))))))).))).,|||{||}.},,,}},,},,,,,{((((,...))))))))))))).{(((((......{(((({((.(((((.,,(,((({(((,...(((((((((((((((((((((.{(,(((((,..((((((,(((((,,((((((((((((...{((((....))))}..{{{,,,..,..,{{||.,.,,,,(((({(((((,((.{..(((.......))).,})))))..,,))))}}.{{{|,{{{{..{((((....))))).|}}}.,}}),...,..}))))))))))|.{(((((((((((((.{{{(({,,,||{{(.,,}|}..,(((....}}},,{{{{.,,,,,)))){((((((.....))))))}.........((((((((,(((....))))))))))).(((((...,..{{.,(((((.((((((....)))))).)))))...)}.......))))).}},,,}))}}|}})}}))))))))))).))}..(((.((((....)))).))).}),,).))).,}))))),}.))))).)),...))).....))))))(((((({..,(((........)))))))))).)))))))))))),.))))))},}))))))).,,|((.((((((.......))))))))}.,(((,((.,,,..}}.)})){|||,,,.....}}}}............(((..(((((.(((....))).)))))..))).......|})})),,|,..{,..})}))),,..((((((((((((((((,((((({,.,,,}))}}}}..)))).))))}})))).))))))))}((({.....)))),.)))))))}})))..}))..)))...)..))))),............)))))))...))))))...))))))))))))))))).))).)))))...)))))))))}}})))))))).))))..)))))),))).)))).))))))))...)))).....,((((((.((((((........)))))).)))))).,...))))))))))).........{((((((({...}))))))))))))))))((((.....)))).....((((((....)))))}((({...})))...............((((({....(((((...((.........))..))))).)))))).({({{...,)))}),,))))))))))))))))))))((((...((((..{{{,,....{({{{.,,.....{(((({{..,,,(((((,,.....}}|||,||,.})))))).,....))))),|((((((..((.........))..))))))}.|,..,||,{|..{{|,.|{{{{((((((,(((,((((........))))....,(((((((((((.....)))))))))))}....}||,|}}}|||||||}.....,,,....,||,{{.{{,,...,,}},)}{||.((((((....((((.{,...,}))))....)))))).,,,....,|||||,,.}})),),(((((,,,(,{((({(,..,,,{,..,||{|||,..,,,,),},))))))}},,,.}}}}}...}}},,}}....}}}}}..{{{{,.{,,.....))),}}}},)))))))).

Transcripts

ID Sequence Length GC content
ACUCGCUCAACUCGGCGCCGCCGCGGCCCCACGCUCCGGGCCCGUCCUC… 7454 nt 0.4634
Showing 51 to 51 of 51 entries
Summary

The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Forensic Context

A study in porcine skin demonstrated that the MAP4K4 was significantly increased in response to thermal burn injury at 7 days post-exposure [Price et al. DOI:10.080/15569520903097754]. Another study in porcine skin found that the MAP4K4 was significantly increased at 7 days following cutaneous bromine exposure, and it was also increased at 24 hours post-exposure for the 8-minute bromine exposure group, where it was associated with PDGF and Toll-like receptor signaling pathways [Price et al. DOI:10.1016/j.toxlet.2008.08.007].