Basic Information

Symbol
MAPK8IP1
RNA class
mRNA
Alias
Mitogen-Activated Protein Kinase 8 Interacting Protein 1 JIP-1 JIP1 IB1 PRKM8IP C-Jun-Amino-Terminal Kinase-Interacting Protein 1 JNK MAP Kinase Scaffold Protein 1 JNK-Interacting Protein 1 Islet-Brain 1 IB-1 Mitogen-Activated Protein Kinase 8-Interacting Protein 1 PRKM8 Interacting Protein
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005456.4
Sequence length
3050.0 nt
GC content
0.6436

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1362.50 kcal/mol
Thermodynamic ensemble
Free energy: -1408.91 kcal/mol
Frequency: 0.0000
Diversity: 1045.39
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((((((.(((((((((.....)))))))((((.......)))).)))))))).((((((..((((.((((((((((((((.........(((....))).......)))))))))))).((((((((...)))..((((((((((((((((((((((((.((((..((((((((((....(((((..(((((((((((((((.(((........))).))))))))..))))))))))))...))))))))))......)))).)))........(((.(((((((((((((((..((((.......))))((((((....(((((.....(((((((.((((.(((((....((((...))))....(((((((((((((((..(((((((.....)))))))))).)))))))).))))(((((((((((...((...))..))).))))..))))....((((((...))))))((((((.(..(..(..(..(.....)..)..)..)..).))))))((((((.((((((((((((((....(((((....))))).((.(((((((((((((.(((.(((((........(((....)))..))))).))).)))))...)))..)))))))..)))))))....)))))..(((((...((((.((((.(((((.((((......))))..............(((((...((...(((((..(((...((((((((((((.......((((((....)))))).(((((..................)))))....(((..(.((((((......).)))))).)))..........))))))))))))))).))))).))..)))))))))).)))).((((......)))).....(((((((((((......(((((.....))))).)))))))))))(((((.(.((.............))))))))))))...))))).(((((.((.(.((.....))))))))))..(((((........(((....)))........))))))).))))))))))).))))..)))))))))))))))))).......(((((((............)))))))((((((((...((((..........))))....((((((.(.(((((((.......))).)))).).)))))).((((((..((((((((((((.((.((((...(((((.(((.((((......((((((((((((((..((((((((...(((.((.((((...)))))).))))))))))).....)))))..((((.((((.((((....)).)).)))).))))...((((((((((((((((((((...)))).....)))).......)))))).....))))))..(((.........)))..))))))))).....)))).)))...)))))))))))))))))))..((((...))))))))..))))))(((((...(((((.(((((((...)))))....)).))))))))))..))))))))....)))))))))).)))))))).((((((((.(((((((............)))))))(((((((.((((((.((((((.....((((((((((.(.(((...))).)))))))))))(((((..(((.(((..(((((((((((((((((...)))).....))))))))).)))).......))).))).))))))))))))).))))))))))).......(((.....)))........))))))))......))))))))))))).........(((((.....))))))))))))).....(((((((...))))))).((((...(((((((((......))))).))))......(((((.(((((((........(((..(((.((((((.......((((((((((..(((..((((((.(.((((((.(((((((((...(((.(((......)))((((..((((((((((....((((((..............)))))).(((....)))....))))))).)))))))((((((((.((.....)).))))))))..))).....))))))))).((((...)))).((((.((((.(((((((.......(((((..(((......)))..))))).((((((...((......))...(((((((.....)))))))(((((.((((.(((.(((.....)))...))).)))).)))))..))))))((((((((..((((...((((((((.(((((((.(....(((........)))..).))))))))))))))).))))..........)).))))))))))))).)))))))))))))))))))))))).)))))))))))).)))).))).)))....))))))).)))))......)))).((((....)))).))))))).))))))))))..(((((.(((((((((.((((((..(((.(((((((....((((.((..((....))....(((((((.((((((...((((..((((((...............))))))...))))))))))))))))).(((.((.(((.(........).))).)).))).)).))))))))))...).))))))))).))))..))))).))))).....((((.....)))).(((((....))))).........))))).(((((..(((((((((((...((((..(((((.(((.........((((((((.....))))))))....((((((....))))))))).)))))..))))..((((.((((((((.((((((((((..((.((((..(((.(((.......)))))).)))).))....))))(.((((.((((.......))))..)))).).)))))).))))))))...)))).............)))))))))))..)))))
Thermodynamic Ensemble Prediction
,{(((,(((((({(,((((((,(({(.({.((((((((.......)))).))))..)).}}|}||,..{{{,|,((((((((((((......,..(((....))).......)))))))))))).{{{{{}||,||,}|,|,||{{||,,(((((((({((({(((((((,,((((((((((....(((((..(((((((((((((((.(((........))).)))))))).,)))}))))))))...))))))))))...{{.{{((((((((..(((.(.,...,|||)))..))))))))}}.}}....||}}||||.{.,(((((.{({{({{(,{,,|.||}},}}|||.....||}}|||||||,,.(((((((((((((((,.(((((((.....))))))))))}}))))))).)))){{((((({{{....||,,,))..}}}.}})).,)},),|,.((((((...))))))||)).)))||)}.||.|||||,,,.,,.,|.}|,||}||||||||.{|||,.((((((((((((((....(((((....))))).((.((((({(((((((.(((.(((((...|||..|||..|.))|..))))).))).)))))|..,}}..)))))))..)))))))....))))}..}},,,..,,)}.))||}}))}||,{(((......)))}......,}}},}.}||||....{{.,.{{((({{((({{(((((((((((((.,,,,,.((((((....)))))).(((((...........,......))))).,|,|{|,,{.(((((,,.....).))))),.}}}..........))))))))))))),,.,,|||,|,{{||||}|,,({(({,..(((((((.((.{....,)).)))))))..,{{|,||,|{(((((((((({({,(((((.((((...}))).,,....,,.,,,,{(((({{.{((((,..,.({(({(((((.((.(.((.....)))))))))){{{{||||{|{|{{|{|{{,{{(((,(((((({((,,,,,((((((({{(((,(({,((((,{{..,.,.}))))).},,,,.,(((((((............)))))))|{|||{,{{((((((({(..{{{{,||||,{,.|{||||,((({(({((((.{((((,..(((|({(((|||,{{{(({(({{(((((((({((.{(({{{{}}.,||{|}|||}||||}.{{{{{{{{{|{|{{((((..((((((((...(((.((.((((...)))))).))))))))))).....}}}))..((((,(((({(({{{,,{||||}{|||}.|||}..,(((({{{(((((({(({{{({{.,..,..}}}}})).......)))))).}}}})}}}}|{{{{{{...{,,.,|||{,|||||||||.....||||.|||...|,}}}},},))),}}}}}}..))))}}}}|(({{{{...{{(({(((((...(((((.(((((((...))))),...}).)))))))))){{|{||,,,,,,}})))),,,))).))})))))}},|{|{{{,{{{{(({||.,,.,,...,})))))}||{||||,{{{(((.((((((,....((((((((((.{.(((...))).)))))))))))|({{{..(((,,{{..(((((((((((((((((...}))).....))))))))).)))).,.....}}},})).}}})})))))))).)))))))}})),,.....{{{.,,|.)}},.....)}})))))}}}.,,|||||||}|||},,.....}}}.{(((((.....))))))}}|||}|,,,..(((((((...))))))),}}}}}..{((((((((......))))).))))}|||,,,|||,....,})}|,,,..}}||||}}}}}))}.}}.......{{{{{{{|||,,|||,,||||||.|.|||||{,||{|||{{{...||},|||,,,.,,))){{{{.,{((({{{{{{...,||({((,{{,{({,..,,,|||||||.{{{....}}}..,{|||||||,||||.,,((((((((.((.....)).))))))))...,,.....|||}}}}|}.({{{..,))),.||((,((({,{((((((,,.....{{{{{.,|||,,,.,.))),,)}))),|||||||,|((,,,,,,|,...((({{{{....|||||||}((({{.{{||.|||,|||.....}))..,))),))}),)})}}.,||||||((((({{{,,((({...((((((({,(((((((.{.{{,({{...,,,}.}}}..}.))))))))))))))).}}||,.|,.,||.,,}||}}}}}}}}}))}.))))}))))))))))))})))})).))))))))))))..))))))},)))}..})))})),,}}.|,.....,}}},.,,..,}}}),})})))))),.,,))))))))},{((((.(((((((((.((((((..(((.(((((({...,((((.((..(({....,..}}|((((((.((((((,,.({((..,{{{((|,.......,,...,,||))}|.,)))|))))))))))))).|{{.{{.{{|,|,|.,,,},).}}}.}}.))).)).))))))))))...).))))))))).)))).,))))).))))).....((((.....)))).(((((....)))))...|,,...))})),|||||}},||,,,|||||....}|||||}||,.,.....},,))))}),,,},,.,}}}.||||||}}}|((((((....}}}}}}|.}}})...,)))}|,|||||||||},,|}}}|,|||||||}}||}||||}.|||.}}}}},}}}})),}))})),}.}}..,{{{.{{.{{{{,||||.,,,..,)))),,)))))).})})))))}})))))))}))))}}.,,,.....,})}}}}}}}}}}..})))}

Transcripts

ID Sequence Length GC content
AGUCCCGCGGGCCGUGCGCGGUGCUGUGCCGCGCCCUGCCAGACACAGG… 3050 nt 0.6436
Summary

This gene encodes a regulator of the pancreatic beta-cell function. It is highly similar to JIP-1, a mouse protein known to be a regulator of c-Jun amino-terminal kinase (Mapk8). This protein has been shown to prevent MAPK8 mediated activation of transcription factors, and to decrease IL-1 beta and MAP kinase kinase 1 (MEKK1) induced apoptosis in pancreatic beta cells. This protein also functions as a DNA-binding transactivator of the glucose transporter GLUT2. RE1-silencing transcription factor (REST) is reported to repress the expression of this gene in insulin-secreting beta cells. This gene is found to be mutated in a type 2 diabetes family, and thus is thought to be a susceptibility gene for type 2 diabetes. [provided by RefSeq, May 2011]

Forensic Context

A study in mice demonstrated that the ketogenic diet significantly decreased kainic acid-induced increases in the MAPK8IP1 protein level in the hippocampus [Noh et al. DOI:10.1016/J.Neulet.2005.10.073].