Basic Information

Symbol
MASP2
RNA class
mRNA
Alias
MBL Associated Serine Protease 2 Mannan-Binding Lectin Serine Protease 2 Map19 MAP-2 SMAP Mannan-Binding Lectin Serine Peptidase 1 Pseudogene 1 Mannan-Binding Lectin Serine Protease 1 Pseudogene 1 Mannose-Binding Protein-Associated Serine Protease 2 Mannose-Binding Lectin-Associated Serine Protease 2 Mannose-Binding Lectin Associated Protein 19 MASP1P1 MASP-2 Mannan Binding Lectin Serine Peptidase 2 MBL-Associated Plasma Protein Of 19 KD MBL-Associated Serine Protease 2 Small MBL-Associated Protein EC 3.4.21.104 EC 3.4.21
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mechanical injury analysis Chronological age estimation

MANE select

Transcript ID
NM_006610.4
Sequence length
2455.0 nt
GC content
0.5145

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-831.30 kcal/mol
Thermodynamic ensemble
Free energy: -875.16 kcal/mol
Frequency: 0.0000
Diversity: 731.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((...)))(((((((((((((......((((.(((((((......((((((.....((((((....))))))......))))))((((((((((((((....))))))))...(((((((((((((....)).)))).).)))))).(((.(((..((((((((((....(((((((((((((((...(((((((((.(((((.(((((((((((((......(((((((((.(((((((.(.((..(((...)))..(((((((..(((.((...(((((.((..(((((((((((.((((((((........(((((((((((...)))((((......((((...(((((...))))).)))).....))))))))))))............((((((((((((.((((((.(.((((((((..((.(((..((.((((....)))))).))).))...))))).(((((......))).))......))).))))).)))))))))))))).)).))))))))))))))....))))).))))).......)).).)).)))))))((((.((....)))))).....))))))))))..))))))))).((.(((.((......)).))).))(((((......(((((.((((.(..(((((((.((((.(..((((((((((((.((.((((((((((....))))))......((((.((((((...........)))))).)))).....((((..((((((....(((((((..((...((((((((((((((((..........))))))))))..................)).).)))))..))))))).....))))))..)))).......(((((((...))).........((((((....((((((........))).)))((((.....))))..........)))))).))))............((((((((((((((((((((((...((((((.....(((.(((.(((((....)))))....)))...))).....))))))....))))))))))..(((((((((((....)))...(((((.(..(((((.((((((.((.(((((((.(((((((((.((((..(((........))).)))))))).))).....((.((.(((((((......))))))).)).))..(((.((..(((.......)))...)).))).....((((((((.(((((((((.(((((((((.((((((..((((........)))).....)).)))).)))))).))))))))))))))))).)))..(((((.....((.((((((((..(((.....)))..)).)))))).))....)))))))))))))).))..)))))))))))).)))))................))))))))....((((((((.....))))))))................((((.............)))).........((((((.....................))))))))))))))))))...(((((.(......))))))....((((...(((((....((((...((((...((((((((((...)))))..)))))......))))...))))))))).))))))))..)).)))))))))))).).))).).))))...)))..).)))).)))))..)))))..((((....))))(((((....)))))..........(((((((.......)))))))..(((...(((((....))))).))).......((((.....))))))))))...((((.....((((((((.((.((((...)))).)).)))))).))...)))).))))).)).))))).)).((..((((((........)))))).)))))))))...)))).)).(((.((.((((...((((((.....))))))...)))).)).)))(((((((....((((((((((((.(((.(((.(......).))).))).))))))))))))((((..(((((((((((((((((..(((((((..............))))))))))))))(((......))).(((((...))).)).....))))))))))..))))(((..............)))))))))).(((((((((((((.((..........)).)))........))))))))))......(((...((........))..))).))).))))))...........)))))))..)))..))).))).....))))))............(((((((..........)))))))))))))))))).......)))))))))).)))...........................
Thermodynamic Ensemble Prediction
,{{.{{(({.,{|||(((((((((((((......((((,((((({({({{{{(((((,...,.{{|||{|,{.|||||,..,,.|}}}}}||{((((((((((((....))))))))...(((((((((({((....)).)))),,.})))))..,,.,{(||{,((((({((.,.,{{,{{{{,.,,,|||||.,,,||||}|,|||||.|||{{,,|||||||.,{{,(((((({((.(((((((,({(...{,,.,))),..(((((((..(((,((...(((((.((|,,,{(((((((((((((((,{...,,...(((((((((((...))){(((......{{{{...(((((...))))).)))).....}}},))))))))............((((((((((((.((((((.,.((({,,,...,..}}},,||.{{.({..{.{(,,((((((((,((......)).)}}}))))).,}))..}}.,))).})))).)))))))))))))).)),)))))))))))))),}..,},)}.))))).......)).).)),))))))){(((,((,,.,|||}||,.,,,,|||||}}}},,)))}}||}}.{{.||{.{|,..,,,}}.))),),,,(((...,,(((((({(({.......)}}.,,},})))))).)))||,|{{{{||.{{||(({(({{{{{|}}|||,..,.,((((.((((((...........)))))).))))}....{{{{..((((((....(((((((..{,...({({({((((((((((..........)))))))))).,................}}||.}}}))..))))))).....)))))).,))}}))))),})|||||},,.,,}},,....}}||,}}},}},||||{(({{{..{|||.{({,{(((.....|}))|,||,,{{{{{{}||{,,||,..........,,{{{{{((((((((((((((((((..((((((.,...(((.(((.(((((....)))))....)))...)))....,))))))..}}))))))))))..{((((((((((....}}}...(((((,(..{((((.((((((,((,(((({({.(({((((((.((((..(((,......}))).)))))))).)))..,..{{.({.(((((((......))))))).}}.||..{((.{{,.(((.......))).,.)).))).....,{((((((.(((((((((.((({(((((.((((((..((((........)))).....)).)))).)))))}.)))))))))))))))))}.)),,|||||.....,,.((((((((..(((.....)))..)).)))))).)),,..)))))))})))))).))..))))))))))}}.))))).,..............})))})},.,,.((((((((.....)))))))).......,,.{,.,,.({{{{,{.,,..|,,,,||||.........{(({((,.,,,,,,,,,,,.....|,.}}}}}}})})))))}}}),,,{|||,,|||,|||||},||.,,.((((({(,.,,{{{.,,,{{|,.{{{{,..,(({,....,...|||||,,})},,.}}},},}||.}}}}}|||}{{|}}}},},..,,..,|||..{((({...)))))}}||||,{{{||||..},}}||{((,(((((,..,((((....))))|||||,.}}))),.}}},,||,..(((((((.......))))))),,}},...||||,.,}}))))).,}.}}}}}},{(({.....})))),})))},,}}||...,,||{{{{{{,||,|||{...}})),)),)))))).|,}}})}},|))))},|||)})))|))|{,}}{{((({..,...,,)))}},,}}))))))||||||}}|}}.,{{.{{.{(((,..((((((,....))))))..,)))),)).}}|(((((((....((((((((((((.(((.(((.(......).))).))).)))))))))))}{(((.,(((((((((((((((((..(((((((...,{.........))))))))))))}}{((......))).{{{{,....}}.,,...,})))))))))),,)))}|{{.................))))))),(((({((((((((.((..,,,,....}}.})},..,..,,})))))}}}}...,..,,|,,|||,...,,,})),}||||||||||},||,,,.,|},...,|||||,..}}})})),,}}......,,}},}............(((((((.,........)))))))))))}))))))}},....}))))))))).))),,,.,},,.....,,,}.}},......

Transcripts

ID Sequence Length GC content
AGACCAGGCCAGGCCAGCUGGACGGGCACACCAUGAGGCUGCUGACCCU… 2455 nt 0.5145
AGACCAGGCCAGGCCAGCUGGACGGGCACACCAUGAGGCUGCUGACCCU… 732 nt 0.6544
Summary

This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]

Forensic Context

A study in rats demonstrated that the MASP2 gene, encoding mannan-binding lectin serine protease 2, was significantly altered in expression in liver tissue on day 1 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. In human studies, the MASP2 protein was identified as having higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192]. In human forensic proteomics, the MASP2 was identified as a discriminatory protein for urine classification, exhibiting a Gini impurity score of 0, as it was present in most pure urine samples and in some mixtures containing urine but absent in mixtures without urine [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].