| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACCAGGCCAGGCCAGCUGGACGGGCACACCAUGAGGCUGCUGACCCU… | 2455 nt | 0.5145 | |
| AGACCAGGCCAGGCCAGCUGGACGGGCACACCAUGAGGCUGCUGACCCU… | 732 nt | 0.6544 |
This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
A study in rats demonstrated that the MASP2 gene, encoding mannan-binding lectin serine protease 2, was significantly altered in expression in liver tissue on day 1 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. In human studies, the MASP2 protein was identified as having higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192]. In human forensic proteomics, the MASP2 was identified as a discriminatory protein for urine classification, exhibiting a Gini impurity score of 0, as it was present in most pure urine samples and in some mixtures containing urine but absent in mixtures without urine [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].