| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACCAAGGUGAGGACCAUGUCCCUGUUUCCAUCACUCCCUCUCCUUCU… | 3521 nt | 0.3701 | |
| AGAGGGCCAGCGUCCUUGUCACUGAGUCCCUGCUCUGCAGAAACACCAG… | 3561 nt | 0.3726 | |
| AGAGGGCCAGCGUCCUUGUCACUGAGUCCCUGCUCUGCAGAAACACCAU… | 3576 nt | 0.3728 |
This gene encodes the soluble mannose-binding lectin or mannose-binding protein found in serum. The protein encoded belongs to the collectin family and is an important element in the innate immune system. The protein recognizes and binds to mannose and N-acetylglucosamine on many microorganisms, including bacteria, yeast, and viruses including influenza virus, HIV and SARS-CoV. This binding activates the classical complement pathway. Deficiencies of this gene have been associated with susceptibility to autoimmune and infectious diseases. [provided by RefSeq, Jun 2020]
A study in human postmortem liver tissues demonstrated that the MBL2 is one of eight primary gene biomarkers used for highly specific organ tissue identification, with targeted RNA sequencing showing 98-100% of reads mapping to these liver-specific markers in samples from cadavers with postmortem intervals ranging from 3.5 hours to 37 days [Javan et al. DOI:10.1038/s41598-020-63727-9]. In a separate human sepsis study, the MBL2 was investigated as a potential risk factor, though polymorphisms were not found to have a significant association with sepsis risk in acute myeloid leukemia patients [Li et al. DOI:10.1038/s41598-025-99619-z]. A study in Sprague Dawley rats demonstrated that adolescent morphine exposure in females leads to transgenerational attenuation of morphine self-administration and relapse-like behavior in offspring, with RNA sequencing and qPCR validation identifying dysregulation of the MBL2 in the nucleus accumbens, showing it was downregulated in F1 males and females and exhibited sex-specific expression changes in the F2 generation [Vassoler et al. DOI:10.1016/j.neuropharm.2016.10.006]. A review analyzing traumatic brain injury in humans, rats, and mice notes that the MBL2 is identified in serum and cerebrospinal fluid as a biomarker of brain damage used to evaluate injury severity and correlate with morbidity and mortality [Mangiola et al. DOI:10.1155/2015/736104].