Basic Information

Symbol
MBL2
RNA class
mRNA
Alias
Mannose Binding Lectin 2 COLEC1 MBP-C MBP1 MBP MBL Mannose-Binding Lectin (Protein C) 2, Soluble (Opsonic Defect) Mannose-Binding Protein C Collectin-1 Mannose-Binding Lectin 2, Soluble (Opsonic Defect) Mannose-Binding Lectin (Protein C) 2, Soluble Mannose-Binding Protein Mannan-Binding Protein Mannose-Binding Lectin Mannan-Binding Lectin Collectin 1 HSMBPC MBL2D MBPD
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Drug abuse diagnoses Sudden death from CNS diseases Mechanical injury analysis

MANE select

Transcript ID
NM_001378373.1
Sequence length
3561.0 nt
GC content
0.3726

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-899.80 kcal/mol
Thermodynamic ensemble
Free energy: -970.66 kcal/mol
Frequency: 0.0000
Diversity: 864.42
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((....))))))((.(((((((..((((...))))....(((((((.((((...))))......(((((((.(((....(((..((((.....(((.((((..(((.....)))..)))).))).....(((.(((........((((...))))((((.(((((........)))))))))..))).)))))))..)))..))).)))))))((..(((((((((((((((.....((((...(((...((((((......((((((.((....))..))))))((((((...(((..((((((...((((.....))))..)))))).....)))...)))))).((((((((((((((.((((..((((((.((((.((((.((((....((((....))))...(.(((..........))).).....)))).))))))))...((.((((.((((((.(((((((...(((.(((.(.....).))).)))....)).))))).))))).).)))).))))))))..)))).))))......(((((.((((((((((((....))))).(((((((((((.(((.((.((((....)))).)).....(((((((((((((((.(((((((((.......(((........))).....)))))))))......(((....)))(((((((((((...(((.((.(((((((((.............((((...(((((..............)))))...))))..((((....((((...((((......)))).....))))...))))....(((((((((((..(((((.............)).))).)))))))))))..)))).))))))).)))...)))))))))))))))))))((((............(((.(((....((((.((((((.......((((.(.(((.(((((...((.((((((((((((....)))))..((((((.((....)).))))))......(((.(((((....((((..(((((((((((.......)))))))..))))))))....))))).)))...))))))).))..((((..(((((((((((((........((((((.......(((((...((((((((((((..(((.....)))..)))))))).......))))....)))))(((((((((..(((((......)))))...)))))))))..........))))))........))))).)))))))).))))...((((((........((((.....)))).........)))))).....((((((.((.((((.(.((((((((((((((((((...(((.......((((((((((((((((((((...(((((...((.((((..............((((((.........))))))....((((((((((....((.((((((((((((((((((.((((.((.......)).)))).))))))..)))))))))...........))).)).....)))))))..))).....((((((((.((.(((((..............(((((((.....(((((.((.((((((.((...........((((((......(((....((((.....((.(((....))).))..))))...)))...)))))))).)))))).....((((((((((...((...((((((.((...)).))))))....))......))))))))))..))))))))))))))((((((((..(((.....((.....))....)))..))))))))..))))))).)))))))).((((......))))(((((.((((........)))).))))))))).))...))))))))).......((.(((.((.(((((.......))))).)).))).))......))))).)))))))))))...........(((((((.(((((.....))))).))))))).....((((((...(((((.((((......)))))))))(((((((((...(((....(((.((((((((.....(((((((....(((..(((...(((.(((.((((.....)))).)))..)))...)))..)))....)))))))..))))))))..))).)))....)))).)))))....((((((((((....((((((((((((((((.............))))))..))))))))))....)))))).))))..............))))))....(((((...((((((((((.(((((((((((((.((((((((...)))))))).)))))))))))))))))))))))...))))).........((((.......))))....(((((((((......))))))))).((((((.((.(((.....((.((((((((...)))))))).)))))..)).))))))((((....)))))))))))))..)))))))))))).)...)))).)))))))))))))))).))))))))))).)))).))))))....(((((.((.......)).)))))...((((((....)))))))))).((((((.......)))))).............................)))))))............)))))))))))))).(((((((((((((((((.....))))).((((.(((((((((((((((.(((.((..(((..((((......(((...((((........)))).)))))))..)))..))...))))))))).)))))).)))....))))..(((((............))))).))))))))))))....((((((((......(((.....)))......))))))))((((((.(((.((......))))).))))))...((((...((((((((((((.....)))))))....)))))...))))))))))))))))))))))))))...........(((((((.........))))))).......)))))).)))....))))..))))))))))).))))..)))))))))((((((.......((((((.........(((((........)))))................(((.((((((..((.....))..))))))..)))..)))))).......))))))((((((((((.(.((...(((.(((((((((((..(((....)))))))))........(((((((((((............))))))))))).......(((((.((((.......((((((((...........))))))))...)))).)))))))))).)))..)).).)))))).)))).(((((((...((((.((((.(((.....))).)))))))).....)))))))....(((((.......)))))(((......)))))))))).)).
Thermodynamic Ensemble Prediction
..((((.((..((((,..{(((((.((..((((...))))..))..))))))))))..)).)))).,,,(((((({,((((((..{{,{(((,,{,..(((.((((..(((.....)))..)))).))){{{.,{{(,((({,.....{(((,...||,|(((,{(((((........))))))))}.,,)).,,,)))),..,},,))),))}})})}}.,,{|||||||{|||||,,.,,((((.,.(((...{({(((.....{((((((.((....))..))))))|(((((...(((..((((((.{,({((.....)))),.)))))).....)))...)))))}.,{{((({((,((((.((((..((((((.((((.((((.((((....((((....))))...(.(((..........))).).....)))).))))))))...{(.((((.{(((((.(((((((...(((.(((.{.....}.))).)))....)).))))).))))).,.)))).)}))))))..)))).)))),}{,,{((((({((,((,,,,,||.}},})))).{((((((((({,((({((.(({{,,.,|||},||.||||{((((((({{({{((,(((((((({..,,,..,{|,,.,,,,,))).}},.}||||||||{,....(((....)))(((((((((((...(((.({((((((((((.....,{{.,...{((((((((((,..{..{,.....},.,,}..,,))).))))))}}..{{{{,,.{{{{......||||,,...}}}}..,)))},,..(((((((((((..(((,{,....},....,.)}.))).)))))))))))..)))).))))))).)))...))))))))))),,|||}||||,...}}}}.,,,..{((,(((..,.((((.(((((({.....,{(((.(,(((.(((((.,{((,(((((({(((((....))))}..(((({{.{{,...}}.)))))}.,,,,.{((.(((((....((((..(((((((((((.......))))))),.}))}))))....))))).))).,,}))))))..,..((((..(((((((((((((........((((({.......(((((...((((((((((((..,((.....)))..)))))))).......))))....))))){((((((((..(((((......)))))...))))))))}..........})))))........))))).)))))))).))))...((((((.,......((((.....)))).........)))))).,...((((({{((.((((.,.((((((((((((((((((..,{{,.......(((((((((((((((({{{,..,(((((...((.((((...,,.........((((((.........))))))....,,,{{(((((....((,{((,((((((((((((((.((((.{(,......)).)))).))))))..))))))))},.,,,..,.,.}}}.}}....,}}}}}}}..,}},,|,|({(({{{{.{{.{{{{{.....,.......{(((((((.....(((((.((.((((((.{{..........,((((((......(((....((((.....((.(((....))).))..))))...)))...)))))))).))))))}}...((((((((((...((...{(((((.({...}).)))))}....)}.,....))))))))))..,,))))))))))))|(((((((.,(((.,,.,{{...,.}},...}))..)))))))}..})))}}}.})))))}).|||{..,,,.|||}{{(((.((((........)))).))))))))},))...)))))}}},....,..{{.{||,||.{{(((.......)}))).}}.})),))......))))),}))))))))))......{{{({(((((((.(((((.....))))).)))))))....}}|||,,..,(((((.((((......)))))))))|,,,(((,,..,||,....,,..((((((((.{{..{(,,,,|..,,,||}}|||,..||{.,,,.,,(({{{..||||.,,,..,,},,.)}}}})))..,.}||||||..||,||||,..))),,))....))))}}||||..{{(({{((((((....((((((((((((((({.............))))))}.}))))))))).,..)))))),)))},,,,,,,|,.....||||||,{{.{((((...((((((((((((((((((((((((.((((((((...)))))))).)))))))))))))))))))))))...})))}....,,,,,{{{{,,,,,..}}},....(((((((((......))))))))).,,.,.,,,|,{{{.....{(.((((((({...)))))))).)},}}..,,.)))))).}}|....}))}}}}))))))..)))))))))))).}...)))).)))))))})))))))).}}}}))))))).)))),)))}}}....(((((.((.......)).)))))..,((((((....)))))))}))}},))))}}}}}}})}.}))||.|||.}}},.........{(((({..,.,,,,...}}}}}}.....}}}))))))))}}}||,|||||{{|,{{((((..,,.|}}},,{{,,,(((((((((((((((.,,,.,{..(((..((((......(((...((((........)))).)))))))..)))..,,...,},)))))).)))))).)}}....,,,,..|||,...,}}}||.,}}}.,}}|)))}}})))))},...,{{,{{{{......,||.....,,.......||||||,,((((((.(((.{(......))))).)))))).....||}}}|...((((((((.....)))))))}....,|||{{{,...,,,,))))))}}))}))))))}{{,..,|||..,|||||||,|,,|,..,}},|||{|,....}}}}}}.}}).,}}))),..}}))))))))}.)}}}..,|},,,|||((((({.......((((((.,.......{((((........))))}....,,......,...(((.((((((.,({.....))..))))))..))).,)))))).......})))))((((((((((.{.{{.,.(((.((((({(((((,,(((....)}})))))},.......(((((((((((...,........))))))))))).......{{(((.((({..,,{{,((((({{{..,.,,..,.,}})}})))}}))))).)))))))))).)))..)).,.)))))).)))).,{{{{{{...(((,{((((.(((.....))).)))))))),,{{,}}}}}},..,,},}..,,.,|,,.,||||||......}}}}},.,,,....

Transcripts

ID Sequence Length GC content
ACACCAAGGUGAGGACCAUGUCCCUGUUUCCAUCACUCCCUCUCCUUCU… 3521 nt 0.3701
AGAGGGCCAGCGUCCUUGUCACUGAGUCCCUGCUCUGCAGAAACACCAG… 3561 nt 0.3726
AGAGGGCCAGCGUCCUUGUCACUGAGUCCCUGCUCUGCAGAAACACCAU… 3576 nt 0.3728
Summary

This gene encodes the soluble mannose-binding lectin or mannose-binding protein found in serum. The protein encoded belongs to the collectin family and is an important element in the innate immune system. The protein recognizes and binds to mannose and N-acetylglucosamine on many microorganisms, including bacteria, yeast, and viruses including influenza virus, HIV and SARS-CoV. This binding activates the classical complement pathway. Deficiencies of this gene have been associated with susceptibility to autoimmune and infectious diseases. [provided by RefSeq, Jun 2020]

Forensic Context

A study in human postmortem liver tissues demonstrated that the MBL2 is one of eight primary gene biomarkers used for highly specific organ tissue identification, with targeted RNA sequencing showing 98-100% of reads mapping to these liver-specific markers in samples from cadavers with postmortem intervals ranging from 3.5 hours to 37 days [Javan et al. DOI:10.1038/s41598-020-63727-9]. In a separate human sepsis study, the MBL2 was investigated as a potential risk factor, though polymorphisms were not found to have a significant association with sepsis risk in acute myeloid leukemia patients [Li et al. DOI:10.1038/s41598-025-99619-z]. A study in Sprague Dawley rats demonstrated that adolescent morphine exposure in females leads to transgenerational attenuation of morphine self-administration and relapse-like behavior in offspring, with RNA sequencing and qPCR validation identifying dysregulation of the MBL2 in the nucleus accumbens, showing it was downregulated in F1 males and females and exhibited sex-specific expression changes in the F2 generation [Vassoler et al. DOI:10.1016/j.neuropharm.2016.10.006]. A review analyzing traumatic brain injury in humans, rats, and mice notes that the MBL2 is identified in serum and cerebrospinal fluid as a biomarker of brain damage used to evaluate injury severity and correlate with morbidity and mortality [Mangiola et al. DOI:10.1155/2015/736104].