Basic Information

Symbol
MBTPS1
RNA class
mRNA
Alias
Membrane Bound Transcription Factor Peptidase, Site 1 SKI-1 S1P KIAA0091 PCSK8 Membrane-Bound Transcription Factor Site-1 Protease Endopeptidase S1P Site-1 Protease EC 3.4.21.112 Membrane-Bound Transcription Factor Protease, Site 1 Proprotein Convertase Subtilisin/Kexin Type 8 Subtilisin Kexin Isozyme 1 Subtilisin/Kexin Isozyme-1 Subtilisin/Kexin-Isozyme 1 SEDKF CAOP SKI1
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_003791.4
Sequence length
4377.0 nt
GC content
0.5111

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1549.40 kcal/mol
Thermodynamic ensemble
Free energy: -1628.33 kcal/mol
Frequency: 0.0000
Diversity: 1112.52
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((........))((((......)))).(((((.(((...((((((..(((((.((((..((((((((((.((((((.....)))))).((((........)))).))))))))))...))))((((...(((..((...(((((.((((...)))).)))))))..))))))).)))))((((((((((((((((.(.(((...((((.((((((.((((((....))))))((((.((((....)))).))))...((((((((.....(((......))).(((((((((.(((((..((.((.((((((...)))))).)).))..................))))))))))))))........((((((((((((((.....(((((((((...((((.(((((((....(((((...((((..((((((((((...)))))...........(((((((..((.....)).))))))).(((((((..............(((.(((((......))))).)))(((((..((((.....)))).)))))(((.(((((((((((((((((((....((((((.(((((.....((..(((((....)))))....))......))))).)).)))).((((((........))))))(((((((.....(((((((.....((((((...((.(((((((...((.........))...))))))).))))))))((((((((..(((........))).))))))))))))))))))))))..((((((((............((.((((...)))).))))))))))((((((((((...((............(((((((((.....((((..............))))...)).)).)))))(((((((....)))))))...))...))).)))))))....)))))).......(((.(((..(((((.((((((....((((......))))(((((((((..(((((..((.(((.((((.(.((((((.((((((..((...((((.(((.(((.(((((....)))))))).))).))))))))))))..).)))))...).)))).))).))))))).))))..)))))..((((..(((........)))..))))........(((((((((((((((((........))))..((((((((((.......((((((.(..(..(.(((....))).)..).).)))))).((.((((((.((((((.(.(((......))).)))))))...)))))).)).(((((.......))))).))))))))))(((((((((...((((.(((((((............))))))).))))((((.(((.(((.(((((((...(((..(((.(((.(((..((((((((((..((.....((((..(((((((...((((((.((((.(((...(((((((((((((........))).....))))))))))..))).))))))))))....)))))))...)))).....)).)))))).............(((((((.(((((((((((.((((((......(((..(((............)))..))).((.(((((......)))))))((....))(((..((..((((.(((.((((.(......).)))))))))))..))..)))......((((((.....))))))))))))..))))))))))))))))))))))))).)).).)))..)))...)))).))).)))...)))))))..(((((((.....))))))).......))))))))))))).))))))))).))))))))))).)))...)))..)))))))))))))))).((((..........))))...)))))))..)))))))))..)))))...)).)))))..))))..(((((((......(((.....))).....)))))))(((...((((((((((...........(((((.((..((((........))))..)))))))...))).)))))))...))).......))))))))).(((..((((((......)))))))))...(((((((((......))))...)))))........))))))))))))))(((((((...)))))))..))))))))))))))))))....))).)...)))))).......))))))))))..((((((.....))))))...)))))).(((((.(((((((((.(((((((((.....(((((((.((((((((((((((.((((..(((((((...(((..(((.((((......((((....))))..(((..(((((((((.....((((.((((((((((.....((((((((......((((............)))).((((.((((((((((((((((...((((...((((((...(((....(((.(((((..(((....))).(((((((.(((((.((((((((((((((((((((..((.(((((((((((((..(.((((((((........)))))))).)..)))))...(((((((((.((...(((...(((((..(((.....))).))))).))))))).))))))).))))))))))))))((((......))))..)))))).......(((...(((((.(((((((((..((.((((...)))).((((((........))))))..))..))))))))))))))....))))))))))..))).))))).)))))))(.((((((((((((((....(((((......))))).))))))))).))).)).)...(((((((((..((((((((((........((((((((((..........))))))))))....(((((......((((((((((.((.(((((......))))).)).))))....))))))..(((((((((((((((((((((...((((..((((...(((.(((.(.(((((.(........)))))))))).)))...))))..))))....))))))).)))...(((((((((...((((.((.(((......((((((...((....))..))))))))).))))))...)))))))))((((((((((.......)))))))).))((..(((((......)))))..)).((((((...))))))....)))))))))))..))))).....(((((...((((.........))))....)))))))))))))..))....))))))))).))))).)))......)))...))))))...))))))))............))))...((((......))))(((((....(((((((....((((((.(..(((.(((((((...))))..)))))))))))))....))))).)).)))))..)))))))).)))).....))))))))))))).)))))...)))).....)))))))))..))).....((((.......))))...)))).)))....((((((...((..(((((((((........(((((((((((((..(.((...(((((...)))))((((...)))).((((((((((........))))))))))..)))..))))))))))))))))))))))..)).(((((.((......)).)))))((((((..((((((((((((((......)))).)))))))))).((((((((.((.(((..((((.(((((..(((.....)))((((((((...))).)))))((((((((.((((......)))).))))...))))))))).)))).))).)).))......))))))..)))))).......(((.((((....)))).)))((((((......))))))..............))))))..(((((........)))))....))).)))))))....)))).))..)))).(((((........))))).((((.......))))...((((.((.(((.((((((((((..(((......))))))))))..))).))).)).))))....((((.((((((.(((..((((....))))..))).))))))..))))......(((((.....))))).....)))))))).))).)))).....))).)))))).)))))..))))...)))))...((((((......))))))(((....)))...............))))))))..))))...
Thermodynamic Ensemble Prediction
.((((((,,,,|}..(((((((((((.((((.......((((((((((((((,.(((.((((..((((((((((.{(((((.....)))))}.((((........)))).))))))))))...)))).)))..},,...)))))}})))))))((((,{{.(((.(((......))))))},,)))))))).)))))))).))){({{{({((,{{{(((,((((((....)))))),|||}|(((({((((((((((.{.,....|,}.)))))))).}}}.)))).(((((((((.(((((..((,((.((((({...}))))).,}.}}................,,)))))))))))))).,{{{{,,{{((((({(((((...,,,{,,(((((((({((((.(((((((....(((((...((((..(((({(((((...)))))..,},.,,,,,(((((((..((.....)).))))))).|||||({..............(((.(((((......))))).)))(((((..((((.....)))).)))))(((.(((((((((((((((((((..{,,,{{{({(((((...{,((..(((((....)))))....,|{,{,,.,}}}}.}},||||,((((((........))))))(((((((.....(((((((.....((((((...((.(((((((...((.........))...))))))).))))))))((((((({..(((......,.))).))))))))))))))))))))))..((((((((,..........,{{.{(({...}))),))))))))))|{((({{,,,...||...,,,}..,|,||||||{,,.....{(({.{.,..........}},,..,))}},.))))}{((((({....)))))))...}}...},}.)))}}))....)))))),......||,.(((..(((((.((((((,{{{(((((({{,.,|..(((((((((..{((((,,((.(((.((((,(.((((((.((((((..{{..{((((.(((.(((.(((((....)))))))).))).)))))}))))))..)})))))...}.)))).))).)}))))).))))..))))).,{((,..,,,..}}}}.,}))}}))})}}}}....(((((((((((((((((........))))..((((((((((.......((((((.{..{..(.(((....))).)..}.}.)))))).((.((((((.(((((,{(.(((......))).)))))))...)))))).)).(((((.......))))).)))))))))){((((((((...((((.(((((((............))))))).))))((({{(((.(((.(((((((...(((..((,.,{,,{,,...||,,(((((((,(((({((({(.,(((({((.,.(((((({((((.(((...(((((((((((((........))).....))))))))))..))).)))}))))))....}}}}}))...}))}.....,},}}}}}}||..,,})},,,.(((((((.(((((((((((.(((((({({...{..{{(((.(({{{{,,|.,}},,.....|{.(((((......))))),|((....))|((..((,.((((.(({,((((,(...,},).})))))))))).,))..))}.}}}}}|,||}}}....,,,}))))))))..)))))))))))))))))))))))),}))))})))..)))...)))).))).)))...)))))))..(((((((.....))))))).......))))))))})))).))))))))).))))))))))).)))...,,,..)))))))))))))))).||{{{{,,,,.,..}}}}...,))))))..}}}},))))..)))))...)),}))))..)))),},,.}})))))}..||,.}}},)))}|.,,{,|{|||(((...((((((((((,,,.....,,}(((({,((..((((........))))..)))))))...))).))))))).,,||}.....,)))}|,,,,((((,.{{((|({{{{{.||||}|||||{{.(((((((((......))))...))}}}........((((,,.,)))).((((((((...)))))))}.}}}}.,}}))))),,}})}..,}.||||{||{,|..,|||.|{{{{{,,||||,}||{{.((((((((((((((((,.,((((((((((.({{{....{(((,,.{(,..,,.{({{...,,...{(((((((.{,,,{{,,,,.....,||({{{(((((((.(,{((..{,(.,.{||||((({..{((,(,.{..((((((,({(((,(((((.....,,,|}}|||,...,,,,{({.{,,.,..,.,,}))}}}..{{(((((((((..........)))),,))))})||,..{{{{|||((({(,{{(({(({{(({({,{.,.||}},(((((,,,|||||{{{{{{{{,|||||,,,}||{,{((((((........)))))))))))))}))))))).)).)}}}}}))),}}})}}},}.,,..))))))},)))),})}},,,|,|{||,,|{|||{{{{{||{|||,|,.||,|||||.({,,,,|},,}}.)),..),))}}|,,,,}}}}}}},,||{{,,(((({,,,,..,|}||||,,,}))),||,|||..,},,,||((((.....))))))))))))))))}|{{{..,,,)))},))}}.})))}}}.}}}.)))))))}(((((((((....(((({......})))).))))))))).{((.{{.,((.(((((((((.,.{((((((((,....,,,{(((((((((..........)))))))))}....(((((...{,,((((((((((.((.(((((......))))).)).))))....))))))..(((((((((((((((((((((...((((..((((...(((.{((.(.(((((.{,.......}))))))})).)))...))))..))))....))))))).)))...(((((((((...((((.((,((...,.{.((((((...((....))..)))))),)))))))))...)))))))))((((((((((.......)))))))).))((..(((((......))))).,)}.((((((...))))))....)))))))))))..)))))....,{{(((,,,((((.........))))....}))))))))))))...,....))))))))).)).)),))).|}}|))}})}}}..((((((((,((,...,,},,.....({{,...}}}|.{{{{....))))}))))))))(((((....((((((.,,,(({,,{,(((|...}))}..,},))}}))))))....))))).|{{{(......))))}.))))))))))......)))))))))))))))).))))},...|||||||....,,,.,}}||||}..}}}|}}))),,,,|,{|||}}||},.(((((...|||||((,(({,..||,||.(((((((((((({.,{.,,.,,|{(({...}}}}}{{{{...((((.((((((((((,.....,.)))))))))).)))),,))))))))))))),|}))}|||{(({((((((.,,....,{}}.})}}}}.}|||}||(((((((({{((({....})))),}}|||||||(((((({,,{{((|(({.{{{|{,((,(,....|.}}.,),,,|||{||{..}))),)))))|||{((((.((((......)))).))))...}))))))})}))))))))}),.},,{{{{{||||||{.{{||..,|||,.,||{,||||,...)))).)))((((((......)))))).......,{,{{{.,,||||,.(((((........))))),,,.|||{{.{((((((,{.....,},})))))}||||..,,,,.,||}||{{((,.,,{{,,{,|,||,{{{{.{{.(((.((((((((((..{((......))))))))))..))).))).,,.|||},||,|{{{.((((((.(((..((((....))))..))).))))))..}}}),}}}},)))||,....}}}|,}}}},}}}}|{{....,,},}}},,,,}}))}.,||.|||},,,...,|||||}}}|,.{((((((......))))))|.....,}))}}.,....,,.....}},))))}..))))...

Transcripts

ID Sequence Length GC content
AGAGCGCGCACGCAAGCCCCGGGAGCGCGGGACAGACAGGGCACGCUGG… 4377 nt 0.5111
Summary

This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014]

Forensic Context

A study in mice demonstrated that chronic methamphetamine administration significantly dysregulates the MBTPS1 in microglia, specifically within the protein processing of endoplasmic reticulum pathway [Oladapo et al. DOI:10.3390/Ijms26020649].