Basic Information

Symbol
MC1R
RNA class
mRNA
Alias
Melanocortin 1 Receptor MSH-R Alpha Melanocyte Stimulating Hormone Receptor Melanocyte-Stimulating Hormone Receptor MC1-R Melanocortin 1 Receptor (Alpha Melanocyte Stimulating Hormone Receptor) Melanocortin Receptor 1 Melanotropin Receptor SHEP2 CMM5 MSHR
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_002386.4
Sequence length
2111.0 nt
GC content
0.6210

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-954.90 kcal/mol
Thermodynamic ensemble
Free energy: -988.15 kcal/mol
Frequency: 0.0000
Diversity: 389.72
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((((.....((..(((((((.((.....(((...........))).....)).)))).)))..))....)))))))))).((((((((((....((((((..(..(((((((((.((((((((.((((((..(((((((.((.((((((.((((((.(((((((((((....)))))))..)))).)))))).....((((((......)))))).))))))((((((((((((((((....((((((.((((((.(((((((((((((..(((((....)))((((((....(((((((..((((....(((((.(((..(((.((((((((.(((((((((..((((.(((((((((..((((((((((((....)).)))))..(((((((((.(((((.(((((((.....))))))).)))))............))))))))).((((....))))((((.......))))..)))))....))...))))))).))))))))).))))..)))))))).((..((..(((((...((((((((.........((((((...)))))))))))))).)))))..)).))......)))))).))))))))).))))))).))))))..))..))))))(((((..((((((...((((((((((((........(((((....))))).((((.(((.(((((((((((..((((.((((..(((((((((...(((...(((.....)))...)))..)))).))))).))))..))))..))))))).....))))))).))))...................((((((.((((((.(((..(((((((.(((((((....))))).))..)))))))....)))))))))))))))))))))))))))))))))..)))))......(((((((.(((((......)).))).)))))))....((((((...(((((((((((..(((((.(((((......))).))))))).))))..)))))))...))))))....(((((((.......(((((((((((.((....))(((((....)))))...)))))))....))))........)))))))...)))))))))))..)).)))))).....)))).)))))))))).))(((((((...(((....(((((((....(((((........(..(((((((..(((((......((((.....(((((...((((((.((((((((................(((((((((....(((.((.(((...))))).)))....)))))))))..((.((((((((..........)))))))).)).))))).)))))))))))))).((((((...((((.(.((((((.(((..((.....))..))).)).........)))).).)))).)))))).)))).....))))).)))))))..)((((((....)))))).(((((((((((.(((..........)))))))))))).)).))))))))))))..))).))))))).(((((..(((((((((.....(((((..(((((.(((((((.......)))))))...((((...))))..((((....))))(((((..(.((((((........))))))).(((((((........(((((((.((((((..((((.......))).)..)))))).).)))))).....)))))))))))))))))..)))))..)))))))))..)))))......((((((((........)))))))).)))))))))..))...((((((((((((....((.....((((((((...)))..)))))))...))))))))))))..(((((((((.((((((((.(((((....)))))))))))))..)))...))))))..))))..)))))).)).)))))))))..).(((((....)).)))..))))))....)).))).)))))......((((.((.(.((((...((((((....)))))).....))))..).))))))......
Thermodynamic Ensemble Prediction
....((((((((((.,,..(({.{((((((,((.....(((...........))).....)).)))).))),.})....)))))))))).((((((((((....((((((..(..(((((((((.((((((((.((((((..(((((((.,..((((((.((((((.(((((((((((....)))))))..)))).))))))...{.((((((......))))))})))))){{((((((((((((((,...((((((.((((({.(((((((((((((,.{((({....))|((((((....(((((((..((((....(((((.{((..(((.{((({,{,.{(((((({,,,((((.(((((((...{((,{((((((,{..,{||.,}||,...{((,,{((.(((((.(((((((.....))))))).))))),..,.}}}...,},|||{{{,{(((,....)))),}}}}}},,..,})).})))))...))}...))))))).))))|||||.,|||{{||}}}}}|{(({.,{}}||||,}}}||||{{||}},..{{..((((((...))))))}))))},}..},))..))}))},,}..)))))}.))))))))).))))))).)))))),.,,,.)))))}(((((..((((((...((((((((((((({,{....(((((....))))).||||({,,((((,(((((((..((((.((((((((((((({(...{((({,.,,.))},},....,))}}}...,))))}.))))..))))..)))))))}}}}.}))}|{{{|..,........,..........{(((((.((((((.(((..{((((((,{((((((....)))))},}..)))))))....)))))))))))))))))))))))))))))))))..)))))......(((((((.(((({......,).))).)))))))....{(((((,..(((((((((((..(((((.(((((......))).))))))).))))..))))))).}.)))))}....(((((((.......(((((((((((.((....)){((((....))))}...)))))))....))))........)))))))...)))))))}}}}}}))}))))))...,.)))).)))))))))).}}(((((((...(((....(((({{,.,,{(((((........|..(((((((..(((((..,...{{((,,,..(((((,..{(((((.{(((((((..,,.,(({(,...,.(((((((((....(((.((.(((...))))).)))....)))))))))}||{|||..((((||........)))))),)})}.))))).))))))))))))))}|(((({|..{(((.{.{((({,.(((.,{,.....}}|.}}}.))|,}|,,...}}}}.}.)))),)))))}.}))).....))))).)))))))..,((((((....)))))).(((((((((((((((..........)))))))))))).)).))))))))))))..))).))))))).(((((..(((((((((.....(((((..(((((.(((((((.......)))))))...{{,{...}}}}..((((....}))){{{{{..(.((((((........))))))}.,,{{{,({{,,,...(((((((.((((((..((((.......))).)..)))))).).)))))).....))))))}})))})))))..)))))..)))))))))..)))))...,,.((((((((........)))))))).)))))))))..)).,.((((((((((((....((,....{(((((((...)))..)))))))...)))))))))))).,(((((((((.((((((((.(((((....)))))))))))))..))),..))))))..))))..))))))},).)))))))))..).(((((....)).)))..))))))....))},)).))))).,....((({,{{.{.((((...((((({....}))))).....})))..}.)))))),,,...

Transcripts

ID Sequence Length GC content
AUUCUUCCCAGGACCUCAGCGCAGCCCUGGCCCAGGAAGGCAGGAGACA… 2111 nt 0.6210
Summary

This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.