| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAGGAAAUCUACAAGCACCAGGAAGUCAAGAUGCAAGCACCAGCCUUC… | 1271 nt | 0.5153 |
This gene encodes a single-pass transmembrane protein. Based on its expression pattern, it is speculated to be involved in regulating mast cell differentiation or immune responses. [provided by RefSeq, Jul 2008]
A study in humans identified the MCEMP1 as a key hub gene for burn injury status, showing significantly higher expression in burn patient skin and blood samples compared to normal controls and demonstrating high diagnostic accuracy with an area under the curve of 95.56% in receiver operating characteristic analysis [Yang et al. DOI:10.3389/fgene.2021.781589]. In a separate human study on acute spinal cord injury, expression of the MCEMP1 in peripheral white blood cells was identified as a candidate biomarker of injury severity [Kyritsis et al. DOI:10.1084/jem.20201795]. In a separate human study, mast cell expressed membrane protein 1 was identified as one of the top 10 upregulated differentially expressed genes in peripheral blood from patients with myocardial infarction [Zhao et al. DOI:10.3892/etm.2017.5580].