Basic Information

Symbol
MCEMP1
RNA class
mRNA
Alias
Mast Cell Expressed Membrane Protein 1 C19orf59 Mast Cell-Expressed Membrane Protein 1 MGC132456 Epididymis Secretory Sperm Binding Protein Chromosome 19 Open Reading Frame 59
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Sudden death from CNS diseases Mechanical injury analysis

MANE select

Transcript ID
NM_174918.3
Sequence length
1271.0 nt
GC content
0.5153

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-439.20 kcal/mol
Thermodynamic ensemble
Free energy: -462.21 kcal/mol
Frequency: 0.0000
Diversity: 268.72
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((....((((.((..(((((........((((...((((((.....(((((.........(((((((.((.........(((((((.((((........)))).).....))))))(((((.((.......((((...((...((((.((.....)).))))....))...))))........)).)))))...)).)))))))......)))))..))))))))))........))))).)).))))..))))))...(((((((...(((((((((.((((((..(((.(((((.((((((((((.(..(((((((..((((..((((((....)))))).......((((((....((((((...((.((((......)))).)).)))))).....)))))).))))....)))))))...).)))))))))).))).))..))).))).))))))))..))))......(((((((..((((((.((((..((((...((..((((((((((((((.((((....(((((.((((((...(((.....))))))))).(((((((.......)))))))((.((..(..(((((....((((.(......).))))....).))))..)..)).)).(((.(((((.(.((((....((((((((((((((..(((.(((((.(((.........))).))))).)))..)).)))))))).((((.(((((((((((....)))..)))))))).)))).(((((((((((....)))))))))))...((((.((((((....)))))).))))((((...((((.((......)).))))..))))..)))).((((.(((((....((((.((((((((....))).))))).)))).))))).)))))))).)))))).))))))))....))))))))))))))..)))).)))).))..)))).))))))((((((((.(((((.(((((...(((((((.((.(((....))).))(((((.((((......)))).))))).(((((........)))))))))))).....))))).)).))).))))))))......((((.(((((.....))))).))))...((((....(((...)))....))))..)))))))...((((((((...........))))))))..(((((((((.....(((((...))))).....).))))))))...))).)))).......
Thermodynamic Ensemble Prediction
((((((....((((.((..(((((.,.,..,.((((...((((((.....(((((.........(((((((.{(,.......,((((((,.{(((........}})).).....))))))|((((.{{.......((((...((...((((,((,....}}.))))....))...))))..,.....)).))))),..}}.)))))))......)))))..)))))))))},.,.|,,.))))).)).))))..))))))...(((((((.,{(((((((((.((((((..(((.(((((.((((((((((.{..(((((((..((((..((((((....)))))).......((((((....((((((...((.((((......)))).)).)))))).....)))))).))))....)))))))...}.)))))))))).))).))..))).))).)))))))),,))}|..,{,.((((((,..,{((((,((((..{(({{{{{{,,(({{((((((((((.((((....(((({.((((((..,(((.....))))))))).{((((((.......))))))}.{{((..{..(((({....((((.{......}.))))....}.}))),.....)})|{(((.(((({,(.((((..,,((((({{{{,,.((..(((.(((((.(((.........))).))))).)))..)).||||}|(((((((.{((((((((((,,,{(((({{(((((((......)))))))}}))))},}}))))))))))).))))))}|..|}},..|||}|,||{,,{{,,},|{||.||,.....)).))))..}}},..}},}.((((.(((((....{(((.((((((((....))).))))).)))}.))))).)))))))).)))))).))))))))....))))))))))))))|,||,|||.||{||..||||,}|||||({{{{||{.{{(((,(((((...({{{{{{.||,|||,,,.})),))|||||,||||,,,...)})),))))),|{{(({{{.....})))))||||}}....})))}}.||,|||,}}}}}}))},||,|((((.(((((.....))))).))))..,|{{{,,,,|||...}}}.,,,))),.,)))))}}...((((((((...........))))))))..(((((((((.....(((({...})))).....),})))))))...))),}))).......

Transcripts

ID Sequence Length GC content
GGAGGAAAUCUACAAGCACCAGGAAGUCAAGAUGCAAGCACCAGCCUUC… 1271 nt 0.5153
Summary

This gene encodes a single-pass transmembrane protein. Based on its expression pattern, it is speculated to be involved in regulating mast cell differentiation or immune responses. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the MCEMP1 as a key hub gene for burn injury status, showing significantly higher expression in burn patient skin and blood samples compared to normal controls and demonstrating high diagnostic accuracy with an area under the curve of 95.56% in receiver operating characteristic analysis [Yang et al. DOI:10.3389/fgene.2021.781589]. In a separate human study on acute spinal cord injury, expression of the MCEMP1 in peripheral white blood cells was identified as a candidate biomarker of injury severity [Kyritsis et al. DOI:10.1084/jem.20201795]. In a separate human study, mast cell expressed membrane protein 1 was identified as one of the top 10 upregulated differentially expressed genes in peripheral blood from patients with myocardial infarction [Zhao et al. DOI:10.3892/etm.2017.5580].