Basic Information

Symbol
APP
RNA class
mRNA
Alias
Amyloid Beta Precursor Protein Alpha-SAPP AD1 Alzheimer Disease Amyloid A4 Protein Homolog Amyloid Beta (A4) Precursor Protein Alzheimer Disease Amyloid Protein Cerebral Vascular Amyloid Peptide Amyloid-Beta Precursor Protein Amyloid Precursor Protein Peptidase Nexin-II Protease Nexin-II PN-II PreA4 ABPP APPI CVAP Amyloid-Beta (A4) Precursor Protein Beta-Amyloid Precursor Protein Testicular Tissue Protein Li 2 Beta-Amyloid Peptide(1-40) Beta-Amyloid Peptide(1-42) Amyloid Beta A4 Protein Amyloid-Beta A4 Protein Beta-Amyloid Peptide Alzheimer Disease CTFgamma ABETA AAA PN2 A4
Location (GRCh38)
Forensic tag(s)
Mixture deconvolution Mechanical injury analysis

MANE select

Transcript ID
NM_000484.4
Sequence length
3583.0 nt
GC content
0.4851

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1123.20 kcal/mol
Thermodynamic ensemble
Free energy: -1189.52 kcal/mol
Frequency: 0.0000
Diversity: 1094.90
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.(...((.((((((((((((.((..((((((......))))))((((((((.(((((.(.((((((((((((((.((((..(.......)..)))).))....)))).))).).))..))).))))).))))).))).((((.((...)).))))(((((.((((((((..(((.((((.((.(....((.(.((..((((((((...(((((.(((((((((.((((((.((((((((.((((..((.((((..((((.((((..(((........)).)..)))))))))))).)).)))).)))))..))).))))........)).))))...))))).((..(((.(((((((((.......((....)).......)))))))(((((....))))).)).)))..))...)))))))).)))))..)).).))...)))))))))))))))))).)))))......(((...)))..)))))))))))))).))..).)))((((((.((..(((((.(((((((((((......(((...(((.....((((..((((((((..((((...)))))))))))).))))......(((........)))(((((((((((((((((((..((((((((.(....))))))..(((((((.(((((((....))))))).))))))).............((((((.(((...(((((((((((((.(((((((((....))(((((((..(((((((.((((((((((..(((((((((.(((...((((....))))........(((((((((((((((((((((.(..((..((((((.(.(..((((((((((((....((...........)).......(.((((((((.(((.((((((((((((.(..((((((((((....((.((((..(((....((((((............((((((.(..((((((...))))))..).))))))..((((....(((((.(.((..(((.......))).)).).)))))....))))..))))))..)))..)))).)).....(((((((.(((((((.(((((.((((.(((((((((...)))..........(((.((.(((((((..(((((((..(((...)))..))))))).....(((((.....)))))...(((((..(((......))).)))))....((((....((((.(((..(((.....))).))).))))..)))).(((.((((....((((.(((........))).)))))))).)))(((((.......)))))(((((((((....((((((((...(((((..((....))...)))))((((((....((((...(((((((((((......((((((((........)))).))))...((((........))))(((((.(((.((((((((((((((((((((((.((((.((((((((.....((.((((((.((((..(((((.....)))...))..)))))))))).)).....))...))))))..))))((((((........))))))((.(((((((((...(((((..((..((.(((((.............))))).))........))..)))))...)))))))))))(((((((((((...((.......))..)))))).....((((........)))))))))(((((((((....))))))))))))))))..((((.(((.(..((.(((......)))))..))))..)))).....))))....)))))))).(((..((.....)).)))...(((..((((((...((.......))...)))))).))).((((((.((.((.((((.((((.....((((.......))))......)))))))))).)).)))))).(((((((((((...)))))..))))))...(((((.(((((((((((.((((((((((........))))))...(((.((((.(((((((...((((((.((.(((((((((.((((((.............)))))).)))))...((((((((..(((((.....)))))...(((.(((((((.((....(((((......)).)))..))..))))))).)))....))))))))....)))).))..))))))...)))..)))).))))..)))....((.((((((((((.(((((.....)))))..))))))..)))).))(((.(((((.........))))))))..((((.....)))).((((((........)))))).))))))))))))))).))))))))))))))))..(((......)))................)))))))))))....))))...............((....)).)))))).....((((((((((.....))))).....(((....))))))))....(((((((((((((((.(((((......))))).(((((((.(((.((((..(((.(((((((...)))))..)).)))..))))..)))...))))))).))).)))))........))))))))))))))).....)))))))))(((((.((....((((.(((((.((((....((((((((((((.((((((.......))))).)..)))))))).......))))....)))).))))).))))...)).))))).))))))).)))))...(((........))).....)))))).)))).)))))...))))))).))))))).......)))))).))))..).)))))).............))))))))).)))))))).)................((((((((((((...))))).)))))))..))))))))))))..).))))))).))...)...)))))))))))))))).)))))..............(((((.(((......))).)))))))).))))))....)))...))))))))))))))...)))..)))))))(((((((((...(.(((....))))...))))))))).))))))).....))))))...)))))))....))).))))))))).))))))))((.((((.(((.....(((..(((((.....((((((.(((...))).))))))..)))))..)))....)))...))))))..))).)))))))).........................(((((..(((((.....((((((..((((........))))......))))))...)))))..)))))........((..((((.((((((((.....(((((((......)))).)))...))))))))))))..)))))...)))......))))))))))).)))))..))..))))))..(((((((((((.((((.....((((((.((..((((.....)))).)).)))))))))))))))))))))..
Thermodynamic Ensemble Prediction
.,{{.{..,((.((((((((((((.(((.((({(,{{.{{,},}|||((((((((.(((((.(.{{(({(((((((((.((((..(.......)..)))).))....)))).))).}.))..}}).))))).)))))}))),((((.((...)).))))(((({.((((((((..(((.((((.((,(....((.(.((..((((((((...(((((.(((({(((({((((({.((((((((.((((..((.(((,.{((((.((((..{((........)}.}..)))))))))))).)).)))).)))))..))}.||||........}},)})).},},))}.||..|||.|,(((((((...,...{{....}}.....,.))))))),{{((,...})))).}}.))).,)),..)))))))).)))))..)).).))...)))))))))))))))))).}))))..,}}}|.|..})),.))))))))))))))).}}..|,}}}((((((.((..(((((.(((((((((((......(((...((((....((((..((((((({..((({...}))))))))))).)))).....((((..({{{{{({((((((((.{,..((((....})}),,.),}))...))))))}.(((((((.(((((((....))))))).))))))).......((.((((((.,.{(.({.(((((((((..((((.{..(((((....)))))(((({{(..{|,,{.,{{{(({({{{(({{{(({{|{{({{{((({.,.{||||.,|||.,,((((((((((((((((((((({({,((,{{{{((,(({({,(((((,,{,,,({{{(.({{((((({...{{{{{.,,.{{(((((({({((((((,((,,(((((((({((,,,,,,,(,{..{(((,(({((.{..{{((((((.,((((((({(.{(((((.{..((((((...))))))..,.)))))}{{,{(((....,|||}},,,..,(({...}}}((((((((.,{{|......,,,..)))((((((((..((((.,,{(((.,..{{{(((((((((((........))}.}))).)))}.,},......)))}}.))))..)))))))}))))))))})).})))))}.|||.|,{{{{,.,{(((.{{{{,||||...{{(((..((({{,..{|||{|}|||,....,......((((.(((..(((.....))).))).))))}}},).}|||}}.|....(((((((((.{.......,,.},))))))))).(((((.......)))))(,{{{{{{|,..,|||||||....|||,,}}||.}}})})).))))).,,|||.,...,{{..{{{{.,,.,}))},,...((((,{,{,..{{{.{||,|{{||,..(((((,,,,,...}}},,}}}))))},,.||||||,|||..,.,,,,.||||,|}||||||.,.....((.((((((.((((..(((((.....)))...))..)))))))))).)),.........)),})})))))..))))}))},))}}))))))}(.(((((((((.,.(((((..{(..({.(((((..........,..))))).})........}}..))))).,.)))))))))),((((((((.{,....,....,,,.,..{{{{{((({,,.{((({{{{(((.,....))))((((((((....))))))))|((((({{.((((((..........,...)))).))..)}})))))|(((((((..,((((..((.(((((......)))))...))..)))},}..)))))))|....}}}}}}}.},},}))..))))).{((,(((.((.(({((,,.,,,|.,}}},||..}}}.}}),,...}}}}))))||||||.||{|,,,,..,|||||||||.,.,||||,..,,))))}..(((((.(((((((((((.(((({(((((........)))))}...{{{.((((.((((((({{.((((((.((.(((((((((.((((((,..,....,..,,)))))).)))))....,{,((,...(((((,...|))}||..,(,(.{,((((,.......||||...,.,})).)))}.}|{{|,,||||{,,,.....))))),.))}})))).})..))))))}},))),.}))).))))..}}}.,,.((,((((((((((,(((((.....))))}..})))}},,)))}.}}||{.(((((.........)))))|||,.{{{{,,,,,))))}||||||..,,,,,.)))))}.))))))))))))))).)))))(((((((,...{{..((({..((((.,..............,.((((((....((....)))))))).,......{{....)}))))))))..})))))))).....)).)))))))},))}}}})}},)))))..{{{((((({,,,,{(((..,,,,,...}}})))))}|||.....})))}}}}).))))}.(((((...)))))....{{(((,|,...,},.}}}))..,,..))))).},}||},.||,||}}}}.})))))))}}}}}))))))}),{{{{{,{{,,..{{{{.(((({.((((,...{{{{((((((((.,(((((.......))))).}..)))))))).....,.}})}..,.)))).})))).}}})..,}}.))}}}..,,||{{{,{{{|,,,|||},,....,,{|{{{{,{{||||{{||}.}|||,,{{,.}|||||)}}}}}}}}}}}}}})))))},))}||},}))))||||,|||..{{,,||}||||||,|||||}||,|,,,{,,,,{,......,||||||((((,..,|||||,|||}}||{,,,,,,)))),,)},..)))))},.,}||,|,,.,})))))))))))))).}}}))|||,|}|||,...,(((((.{{,...,{{||,.||||}((((({{....{{{{,,..})))))))))).)))}..,))}))},{||((({(({(((,,.|,{{{..,,})}|.,.))}})))))))))|||(((,({{||||{{,{|.||}}}}}}}))),)))))},)))))}})})}))}|||},,,...,,)),}}.})}))))...,,,,,,.{,,{{,,||{{|||,,....)))}}))}}...}.))))..))))))))).)},||||,,.,,..,,,................,|,,}}}}}}.}}.,,}||||}...}|}|{({.(((((.........,|||||...,)))|{,|{{({{((({,{,....,}}..})))))))..)),))))).))}{{({{{|.,........},,))))))}...))))...)))......))))))))))).)))))..))..)))))),,{{((((((((({((((.,...(((((({(,{{({,,..,}}),))}))}))}})))))}}))))))))))..

Transcripts

ID Sequence Length GC content
GUCAGUUUCCUCGGCAGCGGUAGGCGAGAGCACGCGGAGGAGCGUGCGC… 3358 nt 0.4809
Showing 11 to 11 of 11 entries
Summary

This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. In addition, two of the peptides are antimicrobial peptides, having been shown to have bacteriocidal and antifungal activities. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2014]

Forensic Context

A study in humans demonstrated that a Bayesian method (NOCIt) determines the a posteriori probability (APP) distribution for the number of contributors (NOC) in forensic DNA mixtures, incorporating models for peak height, stutter, and drop-out [Grgicak et al. DOI:10.1016/j.fsigen.2021.102563]. A study in mice demonstrated that the APP is expressed in the brain following traumatic brain injury, colocalizing with astrocytes and macrophages/microglia in specific brain regions, and exhibits a sex-dependent expression pattern with higher levels in males at early time points post-injury [Soriano et al. DOI:10.1007/s10571-020-00808-3].