Basic Information

Symbol
MCM5
RNA class
mRNA
Alias
Minichromosome Maintenance Complex Component 5 CDC46 DNA Replication Licensing Factor MCM5 CDC46 Homolog P1-CDC46 MCM5 Minichromosome Maintenance Deficient 5, Cell Division Cycle 46 (S. Cerevisiae) Minichromosome Maintenance Deficient (S. Cerevisiae) 5 (Cell Division Cycle 46) MCM5 Minichromosome Maintenance Deficient 5, Cell Division Cycle 46 Minichromosome Maintenance Deficient 5 (Cell Division Cycle 46) EC 3.6.4.12 MGORS8
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_006739.4
Sequence length
3458.0 nt
GC content
0.5633

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1374.00 kcal/mol
Thermodynamic ensemble
Free energy: -1432.48 kcal/mol
Frequency: 0.0000
Diversity: 778.30
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((....((((((((((.(((((.....((((((..((((((((((.(((((((((((((..((.(((((((....(((((((((((....))))))))))).((((.((((....(.((.(.((((...((((...........))))..)))).).)).)...)))).)))))))))))..))..)))).))(((((((((((((((((((...((((..(((.((((((((.......)))).)))))))..)))).........(((((((....(((((.(.((((.(((((((((....(((((((.(((.....))).))))))).....(((((((.(((((..((...)).(((((((((((((((((.(((((((.....)))))))(((((((((....(((((((((((((((((((((.((((((...(((((.((((((...(((((.(((.(((..(((..((.(........).)).)))..))).))).))).))...))))))))....)))..))))))......(((((..(((((((.(((((...((...)).)))).........).)))))))..))))).....)))).))..........((((((((((.....(((((...)))))..)))))..)))))...))))..)))))))).)))((((.......)))).....)))))))))...((((.((........)))).)).))))))).).....))))))))).))))).)).))))).((((...))))(((((((((((..(((((((...((((......)))).)))))))....(((...(((((....)))))..))).)).))))))))).))))))).......)).)))).).).))))..(((((.((((((((((((...(((((((..((((.(((....(((.(.(((((((..(((....))).......((((((((((.((((...)))).))))).)))))))))))).).))))))(((((((((((((.(((((.(((((.((((...........((((((.((((.((((((((.........)))))).............((((....))))((((.((.((((((....))))))))))))....(((((..(((.(((...)))))).))))).(((((....)).)))(((..(((((((......)))))))..))))).)))).)))))).((((.((((....)))).)))))))).)))))..)))))))).)).((((......))))(((.((((((((((((.....)))))......))))))).)))))))))))..(((((((((((..(((((.((((((((...((..((.((((....)))).)).)))))))))).(((((....))))).....((((((.(........)))))))))))).))))))))))).........((..(((((.((.((((((((((((.((((..(((.....))))))).))))))))).)).).)).)))))..)).......))))))))))))))))))))))))))))..(((....((((((......))))))....))).(.((((.((((..(((((.....)))))..)))).)))).).(((((((((((..((((...(((.(((.((((..(((.((......)).)))(((((.....))))).....)))).)))..)))..))))((((.(((((((((.(((.((.((.(((.....))).))...............((((((((((((((((.((.....))..))).......)).))))))).))))........)).)))))))))))).))))...)))))).)))))....)))))))...((.((.(((((((.(((((.(((((........))))).)))))..))))))))).))...)))))))).)))).)))))))....((..((((((....))))))..))))))))).))))))).))).))))))))))).))))))..))))..)).(((((.(((((.....(((...))).....))))).)))))...................((((((((..........(((((((.((.(((.....((((((((((....)))))))))).......(((((((((((.((...(((.(((((.(((.((.(((((((((((.((...)).))))))(((((((.((.((((((((.(((.((((((((((((.(((((....(((((((.........((((........))))((((((((((((....((((...((((..........))))...)))).))).))))))))).((.(((((((((((((....(((...((((((.(((...))).))))))...)))..(((......(((((.((((((.............)))))).))))).....)))...(((((..(((((((..((((((......)))))).))).))))..))))))))))))))))).).))(((((...(((((((.(((((....((((((....))))))((((((((..(((((((.((....((((((((..((((...))))((((.....))))(((((((.(.((((((....))))))...).)))))))))))))))))..))).)))).)))))))).)))))(((.((((....((((((((...))))))))((((...))))..)))).))))))))))...)))))...((((((.....))))))(((.(((.......(((((((((((((((....)))..))))))).))))).....))).)))))))))).))))).).))).))))).......((((((((((((.(((((((.((.......))))))))).)))))).))))))........))).)))..))))))))......(((......))))))))))))..(((....)))....)))))))..(((((((........))))))).........))).))).)).))).)))))))))))))))).)).))))).))((((((....).)))))((((....((((((.......))))))..))))..(((((((((((((.........................(((((..((((............((((((((((....................))))))))))............))))...)))))((((.(((((((((..(((((..((((...((.(((......))).))...)))).)))))...))))))))).)))))))))))))))))..))))))))..
Thermodynamic Ensemble Prediction
,,{{....((((((((((.(((((.....((((((..((((((((((.(((((((((((((..((.(((((((....(((((((((((....))))))))))).{(((.((((..,.{.{{.(.((((...((((.,.....,...))))..)))).).},.}}..)))).)))})))))))..))..)))).))(((((((((((((((((((.,.((((..(((.((((((((.......)))).)))))))..))))|........(((((((....((((,.{.((((.(((((((((....{((((((,(({...,})),.))))))},,....,||,,,.((({{{,(,,.,|{.(((((((((((((((((.(((((((.....)))))))(((((((((.,..(((((((((((((((((((((.((((,,{{((({{,.((((((...(((((.(((.(((..(((..,,..........,.,).)))..))).))).))).))...)))))),,....}})})))})}),,,...(((((..(((((((.{((((...((...,}.)))).........).)))))))..))))).....)))).))..........((((((((((.....(((((...)))))}.)))))..)))))...))))..)))))))).)))((((.......))))....,)))))))))...,{{,.,,.,{{{...,)))}}}.))))))).).....))))))))).))))},)).)))},|((((...))))((((((((({,..{,{((((...,,||}}.,{{|,,,.))))}||....(((.,.(((((....))))),.))).}).))))))))).))))))).......)).)))).}.,.))))..(((({{((((((((((((..,(((((((..(((((((({.,.(({{({((((((,...||}...)))}}}.,,,((((((((((.((((...)))).))))).)))))}}}})))}},))))|,((((((((((((,{(((((.(((((.((({{{..,.|}.,,{(((((.((((.{{((((((.........)))))).,,.....|,{{,((((....}}}}||}}.,|||||((((,{,|}}.,,,)))))}}}}(((((..(({.(((...)))))).))))).(((((....)).)))(((..(((((((......)))))))..))))}.)))).)))))}.((((.,,(({...,))).,,))))}}.)))))..)))))))).)).((((......))))(((.((((((((((((.....)))))......))))))).)))))))))))..(((((((((((..(((((,((((((((...(({.({.,(({....}))),))}..)))))))).{((((,...|}}},..,,}||{|{{.,,.....,.})))),}))))).))))))))))}....,....{(..(((((.((.{(((((((((((.((((..{((.....))})))).))))))))).)).}.)).)))))..)}.....,.))))))))))))))))))))))))))))..(((....((((((......))))))....))).(.((((.((((..(((((.....)))))..)))).)))).).(((((((((((..{(((...(((.(((.((((..(((.((......)).)))(((((.....)))))....,)))).)))..)))..)))}((((.(((((((((.(((.((,{{.(((.....))).,|...............((((((((((((((({,((.........}}),,...}.)).))))))).))))........)).)))))))))))).))))...)))))).)))))....)))))))...{{.{,{(((((((.(((((.(((((........))))).)))))..))))))))}.}}...)))))))).)))).)))))))...,((..((((((....))))))..))))))))).))))))).))).))))))))))).))))))..))))..||.(((((.(((((.....(((...))).....))))).)))))...}}........,,....((((((((..........(((((((.((.(((.....((((((((((....)))))))))).......(((((((((((.{(,.,{{{.,(((...,.,}}||{{{.,(({((,({...,},|||||},|{{{{{,({.((((((((.(((.({((((((((({.(({((.{,,(((((((...((((({(((,........}}))}}..)))))......,{{{{(((((((,.{{,{{,,,{{{{,{{{|||}|||||{.,,,|,},|}},||,||||||||{||,{(({...{|{|||}{{|}||)))|)|||||...|}|.|(((,,....(((((.((((((.{{,......}},)))))).))))),,,,,|}}...(((((..(((((({,.((((((......)))))).))).))))..)))))|||{||.((((({....(((((........))))).}))))),|||||},.,||||||(((((,,..}||||||||||{{{{{,........|,|...}})))))),,....,,(((((((((.{.{(((((....)))))}...,.)))))))))}},,||||||,,,,}}))}}},}}}|{{({.(((((.((((.,,,((((((((...))))))))|||,..,}))),,)))).)))))))))}.})))))),..((((((.....))))))(((.(((...,...(((((((((((({(,....,}}..))))))).)))))...,.))).)))))))))).))))).)}})).))))))......((((((((((((.(((((((.((.,....,))))))))).)))))))}}))))........,}).)))..)))))))).,,,.,{{{,,,,,,||||{(|||||,.||||...,)})}}}}}|||||,..,||||{|,,,,,,,,))))))}.,,..,,}},},}))).},.))),}})))))))))))))).)).))))).))((((((....).)))))((((.{{,((((((.......))))))}}))))..{((((((((((((,,....,,.,{{(({,{,...,,..,||,,}|||,||.,.......,|||||||,|||,,,.....}}}}}},,},},)}||||{{..,....,||,..,}},...{((((........))))}..{(((.(({....|}}.}))),|......,))})))..,|||.,||||.,.,}}})}}}}}})}})})))))}))))}..))))))))..

Transcripts

ID Sequence Length GC content
CCGCGAAACUCGGCGGCUGAGCGUGGAGGUUCUUGUCUCCCCUGGUUUG… 3458 nt 0.5633
Summary

The protein encoded by this gene is structurally very similar to the CDC46 protein from S. cerevisiae, a protein involved in the initiation of DNA replication. The encoded protein is a member of the MCM family of chromatin-binding proteins and can interact with at least two other members of this family. The encoded protein is upregulated in the transition from the G0 to G1/S phase of the cell cycle and may actively participate in cell cycle regulation. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the MCM5 was upregulated in common in splenocytes at day 7 post-injury following burn or trauma-hemorrhage, where it was identified as a gene expression marker associated with DNA replication [Lederer et al. DOI:10.1152/physiolgenomics.00086.2007]. Separate research in zebrafish and mice investigating postmortem transcriptome dynamics identified the MCM5 as a cancer-associated gene whose transcript abundance increased after death [Pozhitkov et al. DOI:10.1098/rsob.160267].