| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUCUCAGAGGGAAUUGAGCACCCGGCAGCGGUCUCAGGCCAAGCCCC… | 2536 nt | 0.5580 | |
| AGCUCUCAGAGGGAAUUGAGCACCCGGCAGCGGUCUCAGGCCAAGCCCC… | 2754 nt | 0.5588 |
This gene encodes a small integral membrane protein with six bilayer spanning domains that functions as a water channel protein. This protein permits passive transport of water along an osmotic gradient. This gene is a possible candidate for disorders involving imbalance in ocular fluid movement. [provided by RefSeq, Aug 2016]
A study in adult albino rats demonstrated that the AQP1 mRNA expression in thyroid and adrenal glands showed significant differences between drowning and postmortem submersion groups at all examined postmortem intervals, with a significant strong negative correlation to PMI enabling estimation models (R²=0.641 for thyroid in drowning) [Allam et al. DOI:10.1016/J.Legalmed.2022.102138]. Another study in Wistar rats found that the AQP1 expression in myocardium significantly increased after severe burns, peaking at 12 hours and correlating with myocardial edema severity [Li et al. DOI:10.3906/sag-1401-149]. A study in human forensic autopsy cases demonstrated that the AQP1 mRNA expression was significantly higher in subacute sharp instrument injury death compared to acute cardiac death and other injury groups, although its immunostaining showed no significant differences in distribution or intensity among causes of death [Wang et al. DOI:10.1007/S00414-012-0758-7]. Another human study investigating mechanical asphyxia found no significant difference in the AQP1 mRNA expression among cause-of-death groups, with the protein clearly detected in all vascular endothelial cells but hardly in bronchial epithelial cells [Wang et al. DOI:10.1016/J.Forsciint.2012.02.013].