Basic Information

Symbol
AQP1
RNA class
mRNA
Alias
Aquaporin 1 (Colton Blood Group) CHIP28 Aquaporin 1 (Channel-Forming Integral Protein, 28kDa, CO Blood Group) Channel-Like Integral Membrane Protein Of 28 KDa Urine Water Channel Aquaporin-CHIP Aquaporin-1 CO Water Channel Protein For Red Blood Cells And Kidney Proximal Tubule Aquaporin 1 (Channel-Forming Integral Protein, 28kDa) Channel-Like Integral Membrane Protein, 28-KDa Aquaporin 1, Colton Blood Group Antigen Colton Blood Group Antigen Bloodgroup CO Protein Colton Blood Group Aquaporin 1 AQP-CHIP AQP-1
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation Cause of death analysis Mechanical injury analysis

MANE select

Transcript ID
NM_198098.4
Sequence length
2754.0 nt
GC content
0.5588

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1089.10 kcal/mol
Thermodynamic ensemble
Free energy: -1136.47 kcal/mol
Frequency: 0.0000
Diversity: 660.73
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((((((((...........(((.((((((.((((((....((((.(((((...(((((((((((((.((((((...))))))((((((...(.(((((((......))))))).)))))))..((((............(((((.(.(((((.........))))).).)))))....))))((((((....(((.(((.((((((((..(((((.....(((((((((.(((((...)))))..(((.((((((..(......)..)))))))))..(((((........))))).....))))))))))))))....)))))))))))((((((((((((...........))))))))))))....)))...))))))..((..(((((............)))))..)))))))))).)))))..........(((((((((((.......(((...((((.(((((((((((.(((.(((...((((((((((((((.....)))))))))..........)))))..)))))).)))))).))))))))).))))))))))))))..((.((((((...(((....))).)))))).)).....))))).).))).......((((.((((((((((((((((.(((.(...........(((((......))))).....((((((.(((((......(((....)))))))).))))))..(((..(((((.(((((((.(((((.((.(((....))).).).)))))..(((....)))...))))))))))))..)))).))))))).))))).....(((.(((((...))))).))).((((...(((((((((((..((.(((((.....((.((.((((((((((.((((((((.((.(((((((((..(((((...(((...((((((...))).)))...)))......))))))))))....((((.((.((((.(...((((.((.(((...(((((((...(((.(........(((((((((...((.(((((((((......)))))).))).))........((((((..(((((........).))))..))))))))))))))).......).))).))))))).))))).)))).).)))).)).))))...))))))))))))))..(((((.....)))))(((.(((((.....(((((((((...........(((..(((((....))))))))......(((((((((..((.((((((((....))).))))).))..))))))))))))))))))..))))))))..((((((((((...(((.....)))...))))))))))..))))))).))).)))).........(((((....(((....))).....)))))))))).)))))).)))))))....).))).))))))))))).........))))))..((((((.......(((((((..(((((...(((((.(((((((......))))))))))))..)))))..)))))))........))))))..)))))).)))((((......)))).(((((((((((((((((((((((....)))(((((.(...(((.(((.(((((((.(((((.....)))))..(((((((((((.((((....)))).((((....))))..((((((...(((((((((((.((........))...)))).)))))))))))))...)))))))))))..........))))))).)))...)))...).)))))..(((((((.(((((((((((...(((((((((......)))))..(((((......))))).(((.(((......))).))).(((.(.((((((.(((..((((.((((((((((((((..(((((....).))))..)))).))).((((((...))))))(((((((.((((((.(((((..(((((((.......)))))))......))))).))))........)).)))))))...)))))))))))))).))))....)).).)))....))))....)))))))))))..)))))))..((((((....))))))..((.(((.((.......)).)))))(((((.......((((.(((((((((((...))))).))))))))))......)))))...........(((((((.(.(((((.......((((((..(((....)))..)).))))...................(((.(((.....((((..(((((....((....)))))))..)).))))).)))((((((((((.(.(((((((((((((((((((..((((((((((((((((...............(((((((.......))))))))))))))........((((((((...((((.(((((((...)))).))).)))).))))).))).(((((((..............)))))))..)))))))))..))).)))))..)))))...)))))).).)))..))))))).(((((.(.(((......))).))))))(((((....))))).)))))...)...)))))))...))))))))))))))))))))))))))))))))).........(((((.((((................)))).)))))....
Thermodynamic Ensemble Prediction
{((((.((((((((,..((({{{..((({(,(({{,{{((((..{{{{,{.((({{,.|||{{{{{((((((.((((((...))))))((((((..,(.(((((((......})))))).))))))}.{(({{,,....,...{{((((({((((((({{{{,..,{|||}},||||,,,.....||,((((((...,(((.(((.((((((((..(((((.....(((((((((.(((({...})))}..(((.(((((({.(......),.)))))))))..(((((..,.....))))).....))))))))))))))....)))))))))))((((((((((((...........))))))))))))....)))...)))))).,|,..,((((,{,...{{,,{{||,,,..)))),,}|||{{||||{{........((((((((((,.......(((...((({{(((((((((((.(((.(((...(((((,(,(((((,,,.{{,,,,,,))),.}}}}}.}.)))))..)))))).))))))},))))))))))),}))))))))))..((.((((((...(((....))).)))))).)).....|||||.|.|||.....,}|{||.{(((({,,{{{{(((({{(({....,.,.....{{(((......)))}}....{((,((({(((((......((({,,,}}}|||,|{}},,)}.|||{,.||||,.|||||||}|||,|}||,|||,,,,|||.,.}.}})))..|||,,}}))).}}))))))))))))}.)})}),))))||{|}}}....,,||,.|||||}}}))}}}.)))}||||...(((((((((((..((.(((((..,,.{(.((.((((((((((.((((((((.((.(((((((((({((({{...(((...((((((...)))}}))...)))......))})))))))....((((.((.((((.(...((((.({,(((...(((((((...(((,(,{,{{,,,(({((((((...((.(((((((((......)))))).))).))........,{{{{(,.(((({........),)))),,))})))))))))))).......,.))).))))))).))))).)))).).)))).)).))))...))))))))))))))..(((((.....)))))((,{(((((.....(((((((({...........{{,.,(((((....)))))))}......(((((((((..((.((((((((....))).))))).))..))))))))))))))))))..)))))))),.((((((((((...(((.....)))...))))))))))..))))))).))).))))},.......(((((....(({....}}),....)))))))))).)))))).)))))))....}.)))})))))))||||.|{|.....))))))}.(((({,..({(,.,,,,{,||}}||||...|{|||,{{{{|||.,}}}.)))))))}}},,,},}}}))},,)))))}.,,}},{||||||.{|,,,|,.,,}|||,}}}}})),},{(((((((((((((((((((((((....)))(((((.{,,.(((.(((.(((((({.(((((.....)))))..{((((((((((.((((....)))).((((....))))..{{{{{{.,,(((((((((((.((........))...))))}}))))))))}}}}..,))))))))))}..........}}))))).)))...))),,.}.))))).{(((((((.(((((((((((...(((((((((......)))))..{((((......))))}.{{(.(((...,..})).}}}.{((.{.((((((.,((..((((.((((((((((((((..(((((....))))))..))))}})){((((({...})))))|((((((,((((((.(((((..(((((((.......)))))))......))))).)))).,,,....}}.))))))}...))))))))))))),.))))....}},}.))}....)))|....)))))))))))..)))))))))((((((....))))))...{.(((.((.......)).)))}{(((((.......((((.(((((((((({...}))))}})))))))))......)))))}..........(((((((.{,({{{|,,.....,{||||,,,,.{{{{,,.})))..,,,....,..,.,.......,,{,,.|}},.,{,{{{,{,(((((.,..,,....)}))))}..||{{{{{..(((((.......})))){({(((({(((((((((({{((((((((((((((((...,...........{{{{(((,,,,,..})))))))))))))........((((((((...((((.(((((((...)))).))).)))).))))).))).(((((((..............)))))))..))))))))).}))}...{((((...))))}))))))))))))),,)))))))(((((.(.(((......))).))))))||||}.}},)}))},))))}.......)))))))...))))))))))))))))))))))}))))))))))....{{((.((({....|,...,.,},,..,,,...{{{{|...}))}}

Transcripts

ID Sequence Length GC content
AGCUCUCAGAGGGAAUUGAGCACCCGGCAGCGGUCUCAGGCCAAGCCCC… 2536 nt 0.5580
AGCUCUCAGAGGGAAUUGAGCACCCGGCAGCGGUCUCAGGCCAAGCCCC… 2754 nt 0.5588
Summary

This gene encodes a small integral membrane protein with six bilayer spanning domains that functions as a water channel protein. This protein permits passive transport of water along an osmotic gradient. This gene is a possible candidate for disorders involving imbalance in ocular fluid movement. [provided by RefSeq, Aug 2016]

Forensic Context

A study in adult albino rats demonstrated that the AQP1 mRNA expression in thyroid and adrenal glands showed significant differences between drowning and postmortem submersion groups at all examined postmortem intervals, with a significant strong negative correlation to PMI enabling estimation models (R²=0.641 for thyroid in drowning) [Allam et al. DOI:10.1016/J.Legalmed.2022.102138]. Another study in Wistar rats found that the AQP1 expression in myocardium significantly increased after severe burns, peaking at 12 hours and correlating with myocardial edema severity [Li et al. DOI:10.3906/sag-1401-149]. A study in human forensic autopsy cases demonstrated that the AQP1 mRNA expression was significantly higher in subacute sharp instrument injury death compared to acute cardiac death and other injury groups, although its immunostaining showed no significant differences in distribution or intensity among causes of death [Wang et al. DOI:10.1007/S00414-012-0758-7]. Another human study investigating mechanical asphyxia found no significant difference in the AQP1 mRNA expression among cause-of-death groups, with the protein clearly detected in all vascular endothelial cells but hardly in bronchial epithelial cells [Wang et al. DOI:10.1016/J.Forsciint.2012.02.013].