| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUGCAGUGACAGUGUGCCUAUGCAGACAGAGGGAGCAGUGAAUAGCAAU… | 1814 nt | 0.5877 |
This gene encodes a member of the aquaglyceroporin family of integral membrane proteins. Members of this family function as water-permeable channels in the epithelia of organs that absorb and excrete water. This protein was shown to function as a water-selective channel, and could also permeate neutral solutes such as glycerol and urea. [provided by RefSeq, Jul 2008]
A study in human neuroblastoma (SH-SY5Y) cells demonstrated that manganese exposure induced a 3.32-fold upregulation of the AQP10 mRNA [Cahill et al. DOI:10.3390/Biom14060647]. A study in Wistar rats demonstrated that severe scald injury induced synchronized increases in myocardial water content and the expression of the AQP10, peaking at 12 hours post-injury, with higher expression and more severe edema observed in a delayed fluid resuscitation group compared to an immediate resuscitation group [Li et al. DOI:10.3906/sag-1401-149].