| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUUUCCGGUUAGCCUUCGGGGUGUCCGCGUGAGAAUUGGCUAUAUCCU… | 1980 nt | 0.4995 |
This gene encodes the 70 kDa subunit of MT-A which is part of N6-adenosine-methyltransferase. This enzyme is involved in the posttranscriptional methylation of internal adenosine residues in eukaryotic mRNAs, forming N6-methyladenosine. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that METTL3 overexpression via AAV9 inhibits pathological hypertrophic cellular growth and fibrosis, while in human and mouse cardiomyocytes under hypoxia/reoxygenation, METTL3 knockdown facilitates autophagic flux and inhibits apoptosis by methylating TFEB mRNA [Chen et al. DOI:10.1155/2021/8813909]. In wound healing research using human and mouse models, the METTL3 was found to be elevated in keloid tissue and promotes fibrosis via the Wnt/β-catenin/S100A4 pathway, while its modification of lncCCKAR-5 inhibits diabetic wound repair in human umbilical cord mesenchymal stem cells [Zhang et al. DOI:10.7150/ijbs.114988].