Basic Information

Symbol
MEX3B
RNA class
mRNA
Alias
Mex-3 RNA Binding Family Member B RNF195 RKHD3 Ring Finger And KH Domain Containing 3 RNA-Binding Protein MEX3B RING Finger Protein 195 DKFZp434J0617 RING Finger And KH Domain-Containing Protein 3 Mex-3 Homolog B (C. Elegans) KIAA2009 MEX-3B
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_032246.6
Sequence length
3405.0 nt
GC content
0.5336

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1266.40 kcal/mol
Thermodynamic ensemble
Free energy: -1326.22 kcal/mol
Frequency: 0.0000
Diversity: 787.51
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((.(((......)))))).....((((((((((((((((.(((.((((((.......((((((((.((.((((..((((((((.((((.(((((((((.....(.((((((((((.(..((..((.(((((((((((......((((.......)))))))..)))))).)).))..))..))))))))))).)((((.....))))))))))))).))))....))).....((((((.((((((((((.(((((.(((((((........)).)))))))))))))))(((.(((((.((((........))))))))).)))..........))))).))))))))))).)).)).)).))))).)))((((((((((((...((((.(((.(...((((......))))..).))).))))))))))).(((((((((((((...((((((((((.(((.((((...)))).))).)))((((((((((((.(((....((((.(((((((((((.((...)).))).))))).)))((....)).((((((((.((((.(((......(((((((((((((((.....................((((.......)))).(((((.((((...((((((...((((((((((.(..(((((((...((((((.((.(((.....))).)).)))))).((((((((.((.(((((((..(((...........)))........)))))))(((((((((((....(((((((.........((((((......((((........))))))))))(((((((((((((.(((....))).))))..((.((((((((((...((....)).((((.....))))...(((....)))....((.((((((..........))))))...))........))))).))))).))..(.((((((((((.(((((((...(((.....((((......(((..(((......)))..)))......))))....))).))))))).)))))))))).)..)))))))))))))))).)))))))))))...))))))).)))..........((.....))........)))))))..)))))).)).)))..)))))))))))))))...)))))).))))))))).................((((..(((...(((.((......)).))).)))..)))).(((........)))(((...((((((...((.((...)).))...)))................)))...))))))))))......(((((((.(..((....))..).)))))))...))))))))(((((((((.((.(((....(((((...((((((......(((((.(.(((......)))))))))...))))))...)))))))).))..)))))))))))))......))).)))))))))..)))..)))))))((((.(((((.((((((.((((.....(((((((((.(.(((.((((........((....((((.((((..((((((((...)).)))))).)))).))))..))..))))))).).))))))))).....)))).)))))).))))))))).(((((((.((((.(......).)))).)))))))(((((((...((((((((.......((((.((((.(((.((((.(((....))))))).))))))).)).))))).))))))))))))...))))))))......))))).............)))))((((.(((((((...(((((.(((...(((((((.......)).)))))..))).)))))))))))).)))).)))))).....(((((((.((((((.((((.....)))))))))))))))))...(((.(((((((((((.......)))).)).))))).)))...((((.(((((....)))))..))))((((.......))))...(((((((((((((((((............))))))))))))))))).))).)))).))))))))))))..((((((...((((......((.....))........))))...))))))(((((..((((((((((((((((((((..(((((((......)))))))...(((..(((.(((((....(((((..........)))))))))).))))))(((((((((((..((....(((((.....)))))....))....(((((.(((..(((((......)))))..))).)))))..((((.....))))......(((((....(((((((((((((...)))))))........((((...(((((.((....)).)))))..))))))))))..)))))....))))).))))))(((.....))))))))..(((((((....)))))))..((((((((.((((((((((....))).)))))))))).......)))))......)))))))))))))))....)))))..((((..((((((...((((((........(((((........))))).))))))..((((((((((((((..((((((((....(((...........))).....))))))))...((((((((.((((((....((((......))))...)))))).))))))))((((((.((((....)))).))))))...(((....)))........)))))))).........(((((....))))).((........))(((((((((((.((((((((((.((.....(((((((..(.((((((...(((((......)))))...)))))).)....)))))))......)).))))).)))))...)))))))))))(((((.((((.(((((...(((((.((((.((((..((.....))..)))).)))))))))....)))))))))))))).....))))))))))))....))))((.((((((((..((((((((((((........)))))............(((..(((((((.....(((((....)))))((((((((((((......((.((((((((((...)))).(((((.....)))))(((((((..((...(((.(((....))).)))..))..))))))))))))).))...(((..(((((((........)))))))....))).)))))).)))))))))))))..))).)))))))..)))...))))).))((((..(((((..(((......)))..)))))...))))))))).....
Thermodynamic Ensemble Prediction
..((((((((.(((......}}}}))..,,.((((((((((((((((.(((.((((((.......((((((((.((.((((..(((((.,,.((((.(((((((((,....(.((((((((((.{..((..((.(((((((((((......((((.{...,.)))))))..)))))).)).})..))..})))))))))).),(((.....))))))))))))).))))...,||,....,((((((.{(((((((((.((({({(((((((........))}}))))))))))))))(((.(((({{((((........))))))))).)))..........))))).))))))))))).)).)).)).))))).)))(((((((((({{...((((({((.....((((,,.{{.||||,,|||,,.{{{({,,,,,,.},,||||||||{{,,,((((((((((.(((.((((...)))).))).)))({((((((((((.(((.,.,((((.(((((((((((.{(...}}.))).))))).)))||....}}.((((((((.,(((({{,...,,.((((((((({(((((.,.......,,,.......,.((((.......)))).(((({{((((...((((((...((({((((((.(..(((((((...((((((,(({(((...}}))).)}.)))))).(((({{{{.{{.(((((((,.(((,........,.)))........)))))))((((((((({(....{{{{||||||||..,((.{(({.....|{(((,....,,,}}}}}})))))}}||||||((((.(((....))).))))..{{.((((((((({,,.{{....||.((((.....))))...(((....)))....{{.((((((..........)))))).,,)}.......,))))).))))).}}{{(.((((((((((.(((((((...((({{...((((......(((..(((......)))..)))......)))).}},})).))))))).)))))))))).).,}.||||}}|||}}}}}.))))))))))}.,,)}))))),}}).,,.,.....{{.....})........)))))))..))))))})).)))..)))))))))))))))..,)))))).))))))))).....,.........|{(({(,,(((...{((.((...,,.)),}}}.))).,)))).(({,,......))),{{,,.||||||},,||,{{.,,}||}....}),................)))..,|||,,,,)))...,.,(((((((.(..((....))..).)))))))..,))))))))(((((((((.((.(((....(((((...((((((......(({((((.(((......)))))))))...))))))...)))))))).))..))))))))))))}......))).))))))))),.}))..))))))){{{,,{{{((.((((((.(({{.....{((|((({(,(,(((,({((,,,.....,.....,{||}||||,,|||||{((,.,||,||||}|,}|||.}}}|.|||{,}||||||.|,||||||}}|.....))||.})))|),)))}}}}},.{{{||{|,||{|||,,.,}.}.)))).)))))))|||{{(({.,(((,,.,|,|{,....||{.{|||||{|.||||.{{|.,,,)}))}}),))))))}})).,,,)).))))))}}}}},.,,)))))))))}}),)))))}}},.....,,,,,}},,,((((.(((((((...(((((.(((...{((((((.......)).)))))..))).)))))))))))).)))).)))))).....(((((((.((((((.((((.....))))))))))))))))).|.(((.(((((((((((.......)))).)).))))).))),..((((.,((((....)))))..))))((((.......))))...(((((((((((((((((............))))))))))))))))).))).)))).))))))))))))..((((((...((((......((.....))........))))...))))))(((((..(((((((((((((((..{{{,.{((((((......))))))}...(((..(((.(((((....(((({..........)))))))))).))})))(((((((((({.,((.,,,(((((.....))))}...,))..,.(((((.{{{..(((((......)))))..}}}.))))).,((((.....))))......(((((....(((((((((((({...})))))),.......((({.{.(((((.((....)).)))))..)))),)))))..)))))....))))).))))))(((.....))),|,{((,{((((((....)))))))}}}.||.{((.(((((({{((....))}.}))))))))},|..,,})))}),...,.)))))))))))))))....)))))..{{{{..((((((...((((((.....,{,(((((........)))))}))))))..{(((((((((((((..((((((((.,{.{{{.,,,.......))),,,..))))))))...((((((((.((((((..,.((((......))))...)))))).))))))))((((((.((((....)))).))))))...(((....)))........)))))))}.........(((((....))))).((........)){((((((((((.((((({((((.((.....(((((((.{({(({{({...(((((......}))))..,)))))).)}}}})))))))......)).))))}.)))))...))))))))))|(((((.(((,{(((((...(((((.((((.((((.{((.....)},})))).)))))))))....)))))))))))))),....)))))}))))))....}}}}{{.((((((((..(((((({(((((........)))))......,,,,{.({(,,{{({(({.,.||{{|||...,})),,((((((((((((.,....((.((((({{{{,...,}}},{{({{...,,||||,|{{{{{|.,{(,..,{,.{{{....))),}}}..))..}})))},)))))).))..,{((..(((((((.,....,.)))))))..}}},},))))))}}}))))}}}})))..}}),)))))))..)),..}))))).}}{{{{,,{{{{{,{(((,,..||}}...})))),},})))))))}.....

Transcripts

ID Sequence Length GC content
GCUUUUCGCUCGGCAUUGCGGCCAGCCAGCCGGGCACUCGGGGGGCACG… 3405 nt 0.5336
Summary

This gene encodes an RNA-binding phosphoprotein that is part of the MEX3 (muscle excess 3) family of translational regulators. The encoded protein contains N-terminal nuclear export and nuclear localization signals and is exported from the cytoplasm to the nucleus. The protein binds to RNA via two KH domains and also colocalizes with MEX3A, Dcp1A decapping factor and Argonaute proteins within P (processing) bodies. [provided by RefSeq, Oct 2012]

Forensic Context

A study in rats demonstrated that Mex3B expression in iliopsoas muscle is part of a biological defense response under severe hypothermia, where its suppression induces Socs3 activation, reduces caspase 3/7 activity, and increases ATP levels, contributing to cell survival via the Socs3-Casp3 axis [Umehara et al. DOI:10.1016/j.legalmed.2022.102150]. The MEX3B is a component of the Mex3B-Socs3-Casp3 axis, which may assist in diagnosing fatal hypothermia [Lei et al. DOI:10.1093/gpbjnl/qzag007].