| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCGCUGCGCCACCGCCUCCCGCCACCCCUGCCCGCCCGACAGCGCCG… | 1607 nt | 0.5557 | |
| GCUCGCUGCGCCACCGCCUCCCGCCACCCCUGCCCGCCCGACAGCGCCG… | 1825 nt | 0.5638 |
This gene encodes the water channel protein aquaporin 3. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein, also known as aquaporin 0. Aquaporin 3 is localized at the basal lateral membranes of collecting duct cells in the kidney. In addition to its water channel function, aquaporin 3 has been found to facilitate the transport of nonionic small solutes such as urea and glycerol, but to a smaller degree. It has been suggested that water channels can be functionally heterogeneous and possess water and solute permeation mechanisms. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
A study in mice demonstrated that the AQP3 gene expression was significantly increased in antemortem burned skin compared to postmortem burns, mechanical wounds, and controls as early as 5 minutes post-burn, while skin water content decreased significantly [Kubo et al. DOI:10.1016/j.legalmed.2014.01.008]. A study in mice and human forensic autopsy cases demonstrated that the AQP3 is expressed in the basolateral membrane of basal cells of the tracheal epithelium [Hayashi et al. DOI:10.1007/S00414-008-0235-5]. In a separate investigation using Wistar rats, myocardial mRNA expression of the AQP3 was found to be upregulated at 12 hours post-scald injury, with fold changes of 2.30 and 2.19 in groups receiving immediate and delayed fluid resuscitation, respectively, compared to controls, as detected by gene microarray analysis [Li et al. DOI:10.3906/sag-1401-149].