| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGGUGUCCGAGAAGUCAGGCACGUAGCUCAGCGGCGGCCGCGGCGCG… | 557 nt | 0.6589 |
This gene encodes a lymphokine involved in cell-mediated immunity, immunoregulation, and inflammation. It plays a role in the regulation of macrophage function in host defense through the suppression of anti-inflammatory effects of glucocorticoids. This lymphokine and the JAB1 protein form a complex in the cytosol near the peripheral plasma membrane, which may indicate an additional role in integrin signaling pathways. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the MIF is a pleiotropic cytokine mediating inflammatory responses through receptor complexes including CD74, CD44, CXCR2, and CXCR4 [Tao et al. DOI:10.1007/s10753-025-02346-w].